From ede8e14355dfabbf41d687cbeae2240f8231f581 Mon Sep 17 00:00:00 2001
From: "fpizlo@apple.com"
 <fpizlo@apple.com@268f45cc-cd09-0410-ab3c-d52691b4dbfc>
Date: Thu, 5 Sep 2013 02:53:16 +0000
Subject: [PATCH] Introduce a version of SunSpider that runs for a really long
 time (about 1 sec on my machine)

Rubber stamped by Mark Hahnenberg.

This isn't meant for serious VM-to-VM performance comparisons, but it is useful
to see how these benchmarks behave when they're completely warmed up.

* LongSpider: Added.
* LongSpider/3d-cube.js: Added.
(DrawLine):
(CalcCross):
(CalcNormal):
(CreateP):
(MMulti):
(VMulti):
(VMulti2):
(MAdd):
(Translate):
(RotateX):
(RotateY):
(RotateZ):
(DrawQube):
(Loop):
(Init):
* LongSpider/3d-morph.js: Added.
(loops.3500.nx.120.nz.120.morph):
* LongSpider/3d-raytrace.js: Added.
(createVector):
(sqrLengthVector):
(lengthVector):
(addVector):
(subVector):
(scaleVector):
(normaliseVector):
(add):
(sub):
(scalev):
(dot):
(scale):
(cross):
(normalise):
(transformMatrix):
(invertMatrix):
(Triangle):
(Triangle.prototype.intersect):
(Scene):
(Scene.prototype.intersect):
(Scene.prototype.blocked):
(Camera):
(Camera.prototype.generateRayPair):
(renderRows):
(Camera.prototype.render):
(raytraceScene.floorShader):
(raytraceScene):
(arrayToCanvasCommands):
* LongSpider/access-binary-trees.js: Added.
(TreeNode):
(TreeNode.prototype.itemCheck):
(bottomUpTree):
* LongSpider/access-fannkuch.js: Added.
(fannkuch):
* LongSpider/access-nbody.js: Added.
(Body):
(Body.prototype.offsetMomentum):
(Jupiter):
(Saturn):
(Uranus):
(Neptune):
(Sun):
(NBodySystem):
(NBodySystem.prototype.advance):
(NBodySystem.prototype.energy):
* LongSpider/access-nsieve.js: Added.
(pad):
(nsieve):
(sieve):
* LongSpider/bitops-3bit-bits-in-byte.js: Added.
(fast3bitlookup):
(TimeFunc):
* LongSpider/bitops-bits-in-byte.js: Added.
(bitsinbyte):
(TimeFunc):
* LongSpider/bitops-nsieve-bits.js: Added.
(pad):
(primes):
(sieve):
* LongSpider/controlflow-recursive.js: Added.
(ack):
(fib):
(tak):
* LongSpider/crypto-aes.js: Added.
(Cipher):
(SubBytes):
(ShiftRows):
(MixColumns):
(AddRoundKey):
(KeyExpansion):
(SubWord):
(RotWord):
(AESEncryptCtr):
(AESDecryptCtr):
(escCtrlChars):
* LongSpider/crypto-md5.js: Added.
(hex_md5):
(b64_md5):
(str_md5):
(hex_hmac_md5):
(b64_hmac_md5):
(str_hmac_md5):
(md5_vm_test):
(core_md5):
(md5_cmn):
(md5_ff):
(md5_gg):
(md5_hh):
(md5_ii):
(core_hmac_md5):
(safe_add):
(bit_rol):
(str2binl):
(binl2str):
(binl2hex):
(binl2b64):
* LongSpider/crypto-sha1.js: Added.
(hex_sha1):
(b64_sha1):
(str_sha1):
(hex_hmac_sha1):
(b64_hmac_sha1):
(str_hmac_sha1):
(sha1_vm_test):
(core_sha1):
(sha1_ft):
(sha1_kt):
(core_hmac_sha1):
(safe_add):
(rol):
(str2binb):
(binb2str):
(binb2hex):
(binb2b64):
* LongSpider/date-format-tofte.js: Added.
(arrayExists):
(.a):
(.A):
(.B):
(.d):
(.D):
(.F):
(.g):
(.G):
(.h):
(.H):
(.i):
(.j):
(.l):
(.L):
(.m):
(.M):
(.n):
(.O):
(.r):
(.S):
(.s):
(.t):
(.U):
(.W):
(.w):
(.Y):
(.y):
(.z):
(Date.prototype.formatDate):
* LongSpider/date-format-xparb.js: Added.
(Date.prototype.dateFormat):
(Date.createNewFormat):
(Date.getFormatCode):
(Date.parseDate):
(Date.createParser):
(Date.formatCodeToRegex):
(Date.prototype.getTimezone):
(Date.prototype.getGMTOffset):
(Date.prototype.getDayOfYear):
(Date.prototype.getWeekOfYear):
(Date.prototype.isLeapYear):
(Date.prototype.getFirstDayOfMonth):
(Date.prototype.getLastDayOfMonth):
(Date.prototype.getDaysInMonth):
(Date.prototype.getSuffix):
(String.escape):
* LongSpider/math-cordic.js: Added.
(FIXED):
(FLOAT):
(DEG2RAD):
(cordicsincos):
(cordic):
* LongSpider/math-partial-sums.js: Added.
(partial):
* LongSpider/math-spectral-norm.js: Added.
(A):
(Au):
(Atu):
(AtAu):
(spectralnorm):
* LongSpider/string-base64.js: Added.
(toBase64):
(base64ToString):
* LongSpider/string-fasta.js: Added.
(rand):
(makeCumulative):
(fastaRepeat):
(fastaRandom):
* LongSpider/string-tagcloud.js: Added.
(.Array.prototype.toJSONString):
(.Boolean.prototype.toJSONString):
(.Date.prototype.toJSONString):
(.Number.prototype.toJSONString):
(.Object.prototype.toJSONString):
(.):



git-svn-id: https://svn.webkit.org/repository/webkit/trunk@155088 268f45cc-cd09-0410-ab3c-d52691b4dbfc
---
 PerformanceTests/ChangeLog                         | 221 ++++++++++
 PerformanceTests/LongSpider/3d-cube.js             | 365 +++++++++++++++++
 PerformanceTests/LongSpider/3d-morph.js            |  63 +++
 PerformanceTests/LongSpider/3d-raytrace.js         | 450 +++++++++++++++++++++
 PerformanceTests/LongSpider/access-binary-trees.js |  54 +++
 PerformanceTests/LongSpider/access-fannkuch.js     |  70 ++++
 PerformanceTests/LongSpider/access-nbody.js        | 174 ++++++++
 PerformanceTests/LongSpider/access-nsieve.js       |  46 +++
 .../LongSpider/bitops-3bit-bits-in-byte.js         |  40 ++
 PerformanceTests/LongSpider/bitops-bits-in-byte.js |  30 ++
 PerformanceTests/LongSpider/bitops-nsieve-bits.js  |  42 ++
 .../LongSpider/controlflow-recursive.js            |  32 ++
 PerformanceTests/LongSpider/crypto-aes.js          | 429 ++++++++++++++++++++
 PerformanceTests/LongSpider/crypto-md5.js          | 295 ++++++++++++++
 PerformanceTests/LongSpider/crypto-sha1.js         | 231 +++++++++++
 PerformanceTests/LongSpider/date-format-tofte.js   | 301 ++++++++++++++
 PerformanceTests/LongSpider/date-format-xparb.js   | 420 +++++++++++++++++++
 PerformanceTests/LongSpider/math-cordic.js         | 106 +++++
 PerformanceTests/LongSpider/math-partial-sums.js   |  45 +++
 PerformanceTests/LongSpider/math-spectral-norm.js  |  59 +++
 PerformanceTests/LongSpider/string-base64.js       | 137 +++++++
 PerformanceTests/LongSpider/string-fasta.js        |  90 +++++
 PerformanceTests/LongSpider/string-tagcloud.js     | 274 +++++++++++++
 23 files changed, 3974 insertions(+)
 create mode 100644 PerformanceTests/LongSpider/3d-cube.js
 create mode 100644 PerformanceTests/LongSpider/3d-morph.js
 create mode 100644 PerformanceTests/LongSpider/3d-raytrace.js
 create mode 100644 PerformanceTests/LongSpider/access-binary-trees.js
 create mode 100644 PerformanceTests/LongSpider/access-fannkuch.js
 create mode 100644 PerformanceTests/LongSpider/access-nbody.js
 create mode 100644 PerformanceTests/LongSpider/access-nsieve.js
 create mode 100644 PerformanceTests/LongSpider/bitops-3bit-bits-in-byte.js
 create mode 100644 PerformanceTests/LongSpider/bitops-bits-in-byte.js
 create mode 100644 PerformanceTests/LongSpider/bitops-nsieve-bits.js
 create mode 100644 PerformanceTests/LongSpider/controlflow-recursive.js
 create mode 100644 PerformanceTests/LongSpider/crypto-aes.js
 create mode 100644 PerformanceTests/LongSpider/crypto-md5.js
 create mode 100644 PerformanceTests/LongSpider/crypto-sha1.js
 create mode 100644 PerformanceTests/LongSpider/date-format-tofte.js
 create mode 100644 PerformanceTests/LongSpider/date-format-xparb.js
 create mode 100644 PerformanceTests/LongSpider/math-cordic.js
 create mode 100644 PerformanceTests/LongSpider/math-partial-sums.js
 create mode 100644 PerformanceTests/LongSpider/math-spectral-norm.js
 create mode 100644 PerformanceTests/LongSpider/string-base64.js
 create mode 100644 PerformanceTests/LongSpider/string-fasta.js
 create mode 100644 PerformanceTests/LongSpider/string-tagcloud.js

diff --git a/PerformanceTests/ChangeLog b/PerformanceTests/ChangeLog
index 726f172..7b98b45 100644
--- a/PerformanceTests/ChangeLog
+++ b/PerformanceTests/ChangeLog
@@ -1,3 +1,224 @@
+2013-09-04  Filip Pizlo  <fpizlo@apple.com>
+
+        Introduce a version of SunSpider that runs for a really long time (about 1 sec on my machine)
+
+        Rubber stamped by Mark Hahnenberg.
+        
+        This isn't meant for serious VM-to-VM performance comparisons, but it is useful
+        to see how these benchmarks behave when they're completely warmed up.
+
+        * LongSpider: Added.
+        * LongSpider/3d-cube.js: Added.
+        (DrawLine):
+        (CalcCross):
+        (CalcNormal):
+        (CreateP):
+        (MMulti):
+        (VMulti):
+        (VMulti2):
+        (MAdd):
+        (Translate):
+        (RotateX):
+        (RotateY):
+        (RotateZ):
+        (DrawQube):
+        (Loop):
+        (Init):
+        * LongSpider/3d-morph.js: Added.
+        (loops.3500.nx.120.nz.120.morph):
+        * LongSpider/3d-raytrace.js: Added.
+        (createVector):
+        (sqrLengthVector):
+        (lengthVector):
+        (addVector):
+        (subVector):
+        (scaleVector):
+        (normaliseVector):
+        (add):
+        (sub):
+        (scalev):
+        (dot):
+        (scale):
+        (cross):
+        (normalise):
+        (transformMatrix):
+        (invertMatrix):
+        (Triangle):
+        (Triangle.prototype.intersect):
+        (Scene):
+        (Scene.prototype.intersect):
+        (Scene.prototype.blocked):
+        (Camera):
+        (Camera.prototype.generateRayPair):
+        (renderRows):
+        (Camera.prototype.render):
+        (raytraceScene.floorShader):
+        (raytraceScene):
+        (arrayToCanvasCommands):
+        * LongSpider/access-binary-trees.js: Added.
+        (TreeNode):
+        (TreeNode.prototype.itemCheck):
+        (bottomUpTree):
+        * LongSpider/access-fannkuch.js: Added.
+        (fannkuch):
+        * LongSpider/access-nbody.js: Added.
+        (Body):
+        (Body.prototype.offsetMomentum):
+        (Jupiter):
+        (Saturn):
+        (Uranus):
+        (Neptune):
+        (Sun):
+        (NBodySystem):
+        (NBodySystem.prototype.advance):
+        (NBodySystem.prototype.energy):
+        * LongSpider/access-nsieve.js: Added.
+        (pad):
+        (nsieve):
+        (sieve):
+        * LongSpider/bitops-3bit-bits-in-byte.js: Added.
+        (fast3bitlookup):
+        (TimeFunc):
+        * LongSpider/bitops-bits-in-byte.js: Added.
+        (bitsinbyte):
+        (TimeFunc):
+        * LongSpider/bitops-nsieve-bits.js: Added.
+        (pad):
+        (primes):
+        (sieve):
+        * LongSpider/controlflow-recursive.js: Added.
+        (ack):
+        (fib):
+        (tak):
+        * LongSpider/crypto-aes.js: Added.
+        (Cipher):
+        (SubBytes):
+        (ShiftRows):
+        (MixColumns):
+        (AddRoundKey):
+        (KeyExpansion):
+        (SubWord):
+        (RotWord):
+        (AESEncryptCtr):
+        (AESDecryptCtr):
+        (escCtrlChars):
+        * LongSpider/crypto-md5.js: Added.
+        (hex_md5):
+        (b64_md5):
+        (str_md5):
+        (hex_hmac_md5):
+        (b64_hmac_md5):
+        (str_hmac_md5):
+        (md5_vm_test):
+        (core_md5):
+        (md5_cmn):
+        (md5_ff):
+        (md5_gg):
+        (md5_hh):
+        (md5_ii):
+        (core_hmac_md5):
+        (safe_add):
+        (bit_rol):
+        (str2binl):
+        (binl2str):
+        (binl2hex):
+        (binl2b64):
+        * LongSpider/crypto-sha1.js: Added.
+        (hex_sha1):
+        (b64_sha1):
+        (str_sha1):
+        (hex_hmac_sha1):
+        (b64_hmac_sha1):
+        (str_hmac_sha1):
+        (sha1_vm_test):
+        (core_sha1):
+        (sha1_ft):
+        (sha1_kt):
+        (core_hmac_sha1):
+        (safe_add):
+        (rol):
+        (str2binb):
+        (binb2str):
+        (binb2hex):
+        (binb2b64):
+        * LongSpider/date-format-tofte.js: Added.
+        (arrayExists):
+        (.a):
+        (.A):
+        (.B):
+        (.d):
+        (.D):
+        (.F):
+        (.g):
+        (.G):
+        (.h):
+        (.H):
+        (.i):
+        (.j):
+        (.l):
+        (.L):
+        (.m):
+        (.M):
+        (.n):
+        (.O):
+        (.r):
+        (.S):
+        (.s):
+        (.t):
+        (.U):
+        (.W):
+        (.w):
+        (.Y):
+        (.y):
+        (.z):
+        (Date.prototype.formatDate):
+        * LongSpider/date-format-xparb.js: Added.
+        (Date.prototype.dateFormat):
+        (Date.createNewFormat):
+        (Date.getFormatCode):
+        (Date.parseDate):
+        (Date.createParser):
+        (Date.formatCodeToRegex):
+        (Date.prototype.getTimezone):
+        (Date.prototype.getGMTOffset):
+        (Date.prototype.getDayOfYear):
+        (Date.prototype.getWeekOfYear):
+        (Date.prototype.isLeapYear):
+        (Date.prototype.getFirstDayOfMonth):
+        (Date.prototype.getLastDayOfMonth):
+        (Date.prototype.getDaysInMonth):
+        (Date.prototype.getSuffix):
+        (String.escape):
+        * LongSpider/math-cordic.js: Added.
+        (FIXED):
+        (FLOAT):
+        (DEG2RAD):
+        (cordicsincos):
+        (cordic):
+        * LongSpider/math-partial-sums.js: Added.
+        (partial):
+        * LongSpider/math-spectral-norm.js: Added.
+        (A):
+        (Au):
+        (Atu):
+        (AtAu):
+        (spectralnorm):
+        * LongSpider/string-base64.js: Added.
+        (toBase64):
+        (base64ToString):
+        * LongSpider/string-fasta.js: Added.
+        (rand):
+        (makeCumulative):
+        (fastaRepeat):
+        (fastaRandom):
+        * LongSpider/string-tagcloud.js: Added.
+        (.Array.prototype.toJSONString):
+        (.Boolean.prototype.toJSONString):
+        (.Date.prototype.toJSONString):
+        (.Number.prototype.toJSONString):
+        (.Object.prototype.toJSONString):
+        (.):
+
 2013-06-10  Radu Stavila  <stavila@adobe.com>
 
         [CSS Regions] Rename region-overflow to region-fragment
diff --git a/PerformanceTests/LongSpider/3d-cube.js b/PerformanceTests/LongSpider/3d-cube.js
new file mode 100644
index 0000000..600b3c0
--- /dev/null
+++ b/PerformanceTests/LongSpider/3d-cube.js
@@ -0,0 +1,365 @@
+// 3D Cube Rotation
+// http://www.speich.net/computer/moztesting/3d.htm
+// Created by Simon Speich
+
+var Q = new Array();
+var MTrans = new Array();  // transformation matrix
+var MQube = new Array();  // position information of qube
+var I = new Array();      // entity matrix
+var Origin = new Object();
+var Testing = new Object();
+var LoopTimer;
+
+var validation = {
+ 20: 2889.0000000000045,
+ 40: 2889.0000000000055,
+ 80: 2889.000000000005,
+ 160: 2889.0000000000055,
+ 320: 2889.000000000006,
+ 640: 2889.000000000013,
+ 1280: 2888.9999999999923,
+ 2560: 2888.9999999999463,
+ 5120: 2889.0000000000405,
+ 10240: 2889.0000000002497,
+ 20480: 2889.0000000000405,
+ 40960: 2888.999999999462,
+ 81920: 2888.999999999193,
+ 163840: 2888.999999998356
+};
+
+var DisplArea = new Object();
+DisplArea.Width = 300;
+DisplArea.Height = 300;
+
+function DrawLine(From, To) {
+  var x1 = From.V[0];
+  var x2 = To.V[0];
+  var y1 = From.V[1];
+  var y2 = To.V[1];
+  var dx = Math.abs(x2 - x1);
+  var dy = Math.abs(y2 - y1);
+  var x = x1;
+  var y = y1;
+  var IncX1, IncY1;
+  var IncX2, IncY2;  
+  var Den;
+  var Num;
+  var NumAdd;
+  var NumPix;
+
+  if (x2 >= x1) {  IncX1 = 1; IncX2 = 1;  }
+  else { IncX1 = -1; IncX2 = -1; }
+  if (y2 >= y1)  {  IncY1 = 1; IncY2 = 1; }
+  else { IncY1 = -1; IncY2 = -1; }
+  if (dx >= dy) {
+    IncX1 = 0;
+    IncY2 = 0;
+    Den = dx;
+    Num = dx / 2;
+    NumAdd = dy;
+    NumPix = dx;
+  }
+  else {
+    IncX2 = 0;
+    IncY1 = 0;
+    Den = dy;
+    Num = dy / 2;
+    NumAdd = dx;
+    NumPix = dy;
+  }
+
+  NumPix = Math.round(Q.LastPx + NumPix);
+
+  var i = Q.LastPx;
+  for (; i < NumPix; i++) {
+    Num += NumAdd;
+    if (Num >= Den) {
+      Num -= Den;
+      x += IncX1;
+      y += IncY1;
+    }
+    x += IncX2;
+    y += IncY2;
+  }
+  Q.LastPx = NumPix;
+}
+
+function CalcCross(V0, V1) {
+  var Cross = new Array();
+  Cross[0] = V0[1]*V1[2] - V0[2]*V1[1];
+  Cross[1] = V0[2]*V1[0] - V0[0]*V1[2];
+  Cross[2] = V0[0]*V1[1] - V0[1]*V1[0];
+  return Cross;
+}
+
+function CalcNormal(V0, V1, V2) {
+  var A = new Array();   var B = new Array(); 
+  for (var i = 0; i < 3; i++) {
+    A[i] = V0[i] - V1[i];
+    B[i] = V2[i] - V1[i];
+  }
+  A = CalcCross(A, B);
+  var Length = Math.sqrt(A[0]*A[0] + A[1]*A[1] + A[2]*A[2]); 
+  for (var i = 0; i < 3; i++) A[i] = A[i] / Length;
+  A[3] = 1;
+  return A;
+}
+
+function CreateP(X,Y,Z) {
+  this.V = [X,Y,Z,1];
+}
+
+// multiplies two matrices
+function MMulti(M1, M2) {
+  var M = [[],[],[],[]];
+  var i = 0;
+  var j = 0;
+  for (; i < 4; i++) {
+    j = 0;
+    for (; j < 4; j++) M[i][j] = M1[i][0] * M2[0][j] + M1[i][1] * M2[1][j] + M1[i][2] * M2[2][j] + M1[i][3] * M2[3][j];
+  }
+  return M;
+}
+
+//multiplies matrix with vector
+function VMulti(M, V) {
+  var Vect = new Array();
+  var i = 0;
+  for (;i < 4; i++) Vect[i] = M[i][0] * V[0] + M[i][1] * V[1] + M[i][2] * V[2] + M[i][3] * V[3];
+  return Vect;
+}
+
+function VMulti2(M, V) {
+  var Vect = new Array();
+  var i = 0;
+  for (;i < 3; i++) Vect[i] = M[i][0] * V[0] + M[i][1] * V[1] + M[i][2] * V[2];
+  return Vect;
+}
+
+// add to matrices
+function MAdd(M1, M2) {
+  var M = [[],[],[],[]];
+  var i = 0;
+  var j = 0;
+  for (; i < 4; i++) {
+    j = 0;
+    for (; j < 4; j++) M[i][j] = M1[i][j] + M2[i][j];
+  }
+  return M;
+}
+
+function Translate(M, Dx, Dy, Dz) {
+  var T = [
+  [1,0,0,Dx],
+  [0,1,0,Dy],
+  [0,0,1,Dz],
+  [0,0,0,1]
+  ];
+  return MMulti(T, M);
+}
+
+function RotateX(M, Phi) {
+  var a = Phi;
+  a *= Math.PI / 180;
+  var Cos = Math.cos(a);
+  var Sin = Math.sin(a);
+  var R = [
+  [1,0,0,0],
+  [0,Cos,-Sin,0],
+  [0,Sin,Cos,0],
+  [0,0,0,1]
+  ];
+  return MMulti(R, M);
+}
+
+function RotateY(M, Phi) {
+  var a = Phi;
+  a *= Math.PI / 180;
+  var Cos = Math.cos(a);
+  var Sin = Math.sin(a);
+  var R = [
+  [Cos,0,Sin,0],
+  [0,1,0,0],
+  [-Sin,0,Cos,0],
+  [0,0,0,1]
+  ];
+  return MMulti(R, M);
+}
+
+function RotateZ(M, Phi) {
+  var a = Phi;
+  a *= Math.PI / 180;
+  var Cos = Math.cos(a);
+  var Sin = Math.sin(a);
+  var R = [
+  [Cos,-Sin,0,0],
+  [Sin,Cos,0,0],
+  [0,0,1,0],   
+  [0,0,0,1]
+  ];
+  return MMulti(R, M);
+}
+
+function DrawQube() {
+  // calc current normals
+  var CurN = new Array();
+  var i = 5;
+  Q.LastPx = 0;
+  for (; i > -1; i--) CurN[i] = VMulti2(MQube, Q.Normal[i]);
+  if (CurN[0][2] < 0) {
+    if (!Q.Line[0]) { DrawLine(Q[0], Q[1]); Q.Line[0] = true; };
+    if (!Q.Line[1]) { DrawLine(Q[1], Q[2]); Q.Line[1] = true; };
+    if (!Q.Line[2]) { DrawLine(Q[2], Q[3]); Q.Line[2] = true; };
+    if (!Q.Line[3]) { DrawLine(Q[3], Q[0]); Q.Line[3] = true; };
+  }
+  if (CurN[1][2] < 0) {
+    if (!Q.Line[2]) { DrawLine(Q[3], Q[2]); Q.Line[2] = true; };
+    if (!Q.Line[9]) { DrawLine(Q[2], Q[6]); Q.Line[9] = true; };
+    if (!Q.Line[6]) { DrawLine(Q[6], Q[7]); Q.Line[6] = true; };
+    if (!Q.Line[10]) { DrawLine(Q[7], Q[3]); Q.Line[10] = true; };
+  }
+  if (CurN[2][2] < 0) {
+    if (!Q.Line[4]) { DrawLine(Q[4], Q[5]); Q.Line[4] = true; };
+    if (!Q.Line[5]) { DrawLine(Q[5], Q[6]); Q.Line[5] = true; };
+    if (!Q.Line[6]) { DrawLine(Q[6], Q[7]); Q.Line[6] = true; };
+    if (!Q.Line[7]) { DrawLine(Q[7], Q[4]); Q.Line[7] = true; };
+  }
+  if (CurN[3][2] < 0) {
+    if (!Q.Line[4]) { DrawLine(Q[4], Q[5]); Q.Line[4] = true; };
+    if (!Q.Line[8]) { DrawLine(Q[5], Q[1]); Q.Line[8] = true; };
+    if (!Q.Line[0]) { DrawLine(Q[1], Q[0]); Q.Line[0] = true; };
+    if (!Q.Line[11]) { DrawLine(Q[0], Q[4]); Q.Line[11] = true; };
+  }
+  if (CurN[4][2] < 0) {
+    if (!Q.Line[11]) { DrawLine(Q[4], Q[0]); Q.Line[11] = true; };
+    if (!Q.Line[3]) { DrawLine(Q[0], Q[3]); Q.Line[3] = true; };
+    if (!Q.Line[10]) { DrawLine(Q[3], Q[7]); Q.Line[10] = true; };
+    if (!Q.Line[7]) { DrawLine(Q[7], Q[4]); Q.Line[7] = true; };
+  }
+  if (CurN[5][2] < 0) {
+    if (!Q.Line[8]) { DrawLine(Q[1], Q[5]); Q.Line[8] = true; };
+    if (!Q.Line[5]) { DrawLine(Q[5], Q[6]); Q.Line[5] = true; };
+    if (!Q.Line[9]) { DrawLine(Q[6], Q[2]); Q.Line[9] = true; };
+    if (!Q.Line[1]) { DrawLine(Q[2], Q[1]); Q.Line[1] = true; };
+  }
+  Q.Line = [false,false,false,false,false,false,false,false,false,false,false,false];
+  Q.LastPx = 0;
+}
+
+function Loop() {
+  if (Testing.LoopCount > Testing.LoopMax) return;
+  var TestingStr = String(Testing.LoopCount);
+  while (TestingStr.length < 3) TestingStr = "0" + TestingStr;
+  MTrans = Translate(I, -Q[8].V[0], -Q[8].V[1], -Q[8].V[2]);
+  MTrans = RotateX(MTrans, 1);
+  MTrans = RotateY(MTrans, 3);
+  MTrans = RotateZ(MTrans, 5);
+  MTrans = Translate(MTrans, Q[8].V[0], Q[8].V[1], Q[8].V[2]);
+  MQube = MMulti(MTrans, MQube);
+  var i = 8;
+  for (; i > -1; i--) {
+    Q[i].V = VMulti(MTrans, Q[i].V);
+  }
+  DrawQube();
+  Testing.LoopCount++;
+  Loop();
+}
+
+function Init(CubeSize) {
+  // init/reset vars
+  Origin.V = [150,150,20,1];
+  Testing.LoopCount = 0;
+  Testing.LoopMax = 50;
+  Testing.TimeMax = 0;
+  Testing.TimeAvg = 0;
+  Testing.TimeMin = 0;
+  Testing.TimeTemp = 0;
+  Testing.TimeTotal = 0;
+  Testing.Init = false;
+
+  // transformation matrix
+  MTrans = [
+  [1,0,0,0],
+  [0,1,0,0],
+  [0,0,1,0],
+  [0,0,0,1]
+  ];
+  
+  // position information of qube
+  MQube = [
+  [1,0,0,0],
+  [0,1,0,0],
+  [0,0,1,0],
+  [0,0,0,1]
+  ];
+  
+  // entity matrix
+  I = [
+  [1,0,0,0],
+  [0,1,0,0],
+  [0,0,1,0],
+  [0,0,0,1]
+  ];
+  
+  // create qube
+  Q[0] = new CreateP(-CubeSize,-CubeSize, CubeSize);
+  Q[1] = new CreateP(-CubeSize, CubeSize, CubeSize);
+  Q[2] = new CreateP( CubeSize, CubeSize, CubeSize);
+  Q[3] = new CreateP( CubeSize,-CubeSize, CubeSize);
+  Q[4] = new CreateP(-CubeSize,-CubeSize,-CubeSize);
+  Q[5] = new CreateP(-CubeSize, CubeSize,-CubeSize);
+  Q[6] = new CreateP( CubeSize, CubeSize,-CubeSize);
+  Q[7] = new CreateP( CubeSize,-CubeSize,-CubeSize);
+  
+  // center of gravity
+  Q[8] = new CreateP(0, 0, 0);
+  
+  // anti-clockwise edge check
+  Q.Edge = [[0,1,2],[3,2,6],[7,6,5],[4,5,1],[4,0,3],[1,5,6]];
+  
+  // calculate squad normals
+  Q.Normal = new Array();
+  for (var i = 0; i < Q.Edge.length; i++) Q.Normal[i] = CalcNormal(Q[Q.Edge[i][0]].V, Q[Q.Edge[i][1]].V, Q[Q.Edge[i][2]].V);
+  
+  // line drawn ?
+  Q.Line = [false,false,false,false,false,false,false,false,false,false,false,false];
+  
+  // create line pixels
+  Q.NumPx = 9 * 2 * CubeSize;
+  for (var i = 0; i < Q.NumPx; i++) CreateP(0,0,0);
+  
+  MTrans = Translate(MTrans, Origin.V[0], Origin.V[1], Origin.V[2]);
+  MQube = MMulti(MTrans, MQube);
+
+  var i = 0;
+  for (; i < 9; i++) {
+    Q[i].V = VMulti(MTrans, Q[i].V);
+  }
+  DrawQube();
+  Testing.Init = true;
+  Loop();
+  
+  // Perform a simple sum-based verification.
+  var sum = 0;
+  for (var i = 0; i < Q.length; ++i) {
+    var vector = Q[i].V;
+    for (var j = 0; j < vector.length; ++j)
+      sum += vector[j];
+  }
+  if (sum != validation[CubeSize])
+    throw "Error: bad vector sum for CubeSize = " + CubeSize + "; expected " + validation[CubeSize] + " but got " + sum;
+}
+
+for ( var i = 20; i <= 260000; i *= 2 ) {
+  Init(i);
+}
+
+Q = null;
+MTrans = null;
+MQube = null;
+I = null;
+Origin = null;
+Testing = null;
+LoopTime = null;
+DisplArea = null;
+
diff --git a/PerformanceTests/LongSpider/3d-morph.js b/PerformanceTests/LongSpider/3d-morph.js
new file mode 100644
index 0000000..affd4c7
--- /dev/null
+++ b/PerformanceTests/LongSpider/3d-morph.js
@@ -0,0 +1,63 @@
+/*
+ * Copyright (C) 2007 Apple Inc.  All rights reserved.
+ *
+ * Redistribution and use in source and binary forms, with or without
+ * modification, are permitted provided that the following conditions
+ * are met:
+ * 1. Redistributions of source code must retain the above copyright
+ *    notice, this list of conditions and the following disclaimer.
+ * 2. Redistributions in binary form must reproduce the above copyright
+ *    notice, this list of conditions and the following disclaimer in the
+ *    documentation and/or other materials provided with the distribution.
+ *
+ * THIS SOFTWARE IS PROVIDED BY APPLE COMPUTER, INC. ``AS IS'' AND ANY
+ * EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+ * PURPOSE ARE DISCLAIMED.  IN NO EVENT SHALL APPLE COMPUTER, INC. OR
+ * CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+ * EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+ * PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR
+ * PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY
+ * OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT
+ * (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE
+ * OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. 
+ */
+
+var loops = 3500
+var nx = 120
+var nz = 120
+
+function morph(a, f) {
+    var PI2nx = Math.PI * 8/nx
+    var sin = Math.sin
+    var f30 = -(50 * sin(f*Math.PI*2))
+    
+    for (var i = 0; i < nz; ++i) {
+        for (var j = 0; j < nx; ++j) {
+            a[3*(i*nx+j)+1]    = sin((j-1) * PI2nx ) * -f30
+        }
+    }
+}
+
+    
+var a = Array()
+for (var i=0; i < nx*nz*3; ++i) 
+    a[i] = 0
+
+for (var i = 0; i < loops; ++i) {
+    morph(a, i/loops)
+}
+
+testOutput = 0;
+for (var i = 0; i < nx; i++)
+    testOutput += a[3*(i*nx+i)+1];
+a = null;
+
+// This has to be an approximate test since ECMAscript doesn't formally specify
+// what sin() returns. Even if it did specify something like for example what Java 7
+// says - that sin() has to return a value within 1 ulp of exact - then we still
+// would not be able to do an exact test here since that would allow for just enough
+// low-bit slop to create possibly big errors due to testOutput being a sum.
+var expected = "-1";
+if (("" + testOutput).indexOf(expected) != 0)
+    throw "Error: bad test output: expected leading digit to be " + expected + " but got " + testOutput;
diff --git a/PerformanceTests/LongSpider/3d-raytrace.js b/PerformanceTests/LongSpider/3d-raytrace.js
new file mode 100644
index 0000000..6e503b6f
--- /dev/null
+++ b/PerformanceTests/LongSpider/3d-raytrace.js
@@ -0,0 +1,450 @@
+/*
+ * Copyright (C) 2007 Apple Inc.  All rights reserved.
+ *
+ * Redistribution and use in source and binary forms, with or without
+ * modification, are permitted provided that the following conditions
+ * are met:
+ * 1. Redistributions of source code must retain the above copyright
+ *    notice, this list of conditions and the following disclaimer.
+ * 2. Redistributions in binary form must reproduce the above copyright
+ *    notice, this list of conditions and the following disclaimer in the
+ *    documentation and/or other materials provided with the distribution.
+ *
+ * THIS SOFTWARE IS PROVIDED BY APPLE COMPUTER, INC. ``AS IS'' AND ANY
+ * EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+ * PURPOSE ARE DISCLAIMED.  IN NO EVENT SHALL APPLE COMPUTER, INC. OR
+ * CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+ * EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+ * PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR
+ * PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY
+ * OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT
+ * (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE
+ * OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. 
+ */
+
+function createVector(x,y,z) {
+    return new Array(x,y,z);
+}
+
+function sqrLengthVector(self) {
+    return self[0] * self[0] + self[1] * self[1] + self[2] * self[2];
+}
+
+function lengthVector(self) {
+    return Math.sqrt(self[0] * self[0] + self[1] * self[1] + self[2] * self[2]);
+}
+
+function addVector(self, v) {
+    self[0] += v[0];
+    self[1] += v[1];
+    self[2] += v[2];
+    return self;
+}
+
+function subVector(self, v) {
+    self[0] -= v[0];
+    self[1] -= v[1];
+    self[2] -= v[2];
+    return self;
+}
+
+function scaleVector(self, scale) {
+    self[0] *= scale;
+    self[1] *= scale;
+    self[2] *= scale;
+    return self;
+}
+
+function normaliseVector(self) {
+    var len = Math.sqrt(self[0] * self[0] + self[1] * self[1] + self[2] * self[2]);
+    self[0] /= len;
+    self[1] /= len;
+    self[2] /= len;
+    return self;
+}
+
+function add(v1, v2) {
+    return new Array(v1[0] + v2[0], v1[1] + v2[1], v1[2] + v2[2]);
+}
+
+function sub(v1, v2) {
+    return new Array(v1[0] - v2[0], v1[1] - v2[1], v1[2] - v2[2]);
+}
+
+function scalev(v1, v2) {
+    return new Array(v1[0] * v2[0], v1[1] * v2[1], v1[2] * v2[2]);
+}
+
+function dot(v1, v2) {
+    return v1[0] * v2[0] + v1[1] * v2[1] + v1[2] * v2[2];
+}
+
+function scale(v, scale) {
+    return [v[0] * scale, v[1] * scale, v[2] * scale];
+}
+
+function cross(v1, v2) {
+    return [v1[1] * v2[2] - v1[2] * v2[1], 
+            v1[2] * v2[0] - v1[0] * v2[2],
+            v1[0] * v2[1] - v1[1] * v2[0]];
+
+}
+
+function normalise(v) {
+    var len = lengthVector(v);
+    return [v[0] / len, v[1] / len, v[2] / len];
+}
+
+function transformMatrix(self, v) {
+    var vals = self;
+    var x  = vals[0] * v[0] + vals[1] * v[1] + vals[2] * v[2] + vals[3];
+    var y  = vals[4] * v[0] + vals[5] * v[1] + vals[6] * v[2] + vals[7];
+    var z  = vals[8] * v[0] + vals[9] * v[1] + vals[10] * v[2] + vals[11];
+    return [x, y, z];
+}
+
+function invertMatrix(self) {
+    var temp = new Array(16);
+    var tx = -self[3];
+    var ty = -self[7];
+    var tz = -self[11];
+    for (h = 0; h < 3; h++) 
+        for (v = 0; v < 3; v++) 
+            temp[h + v * 4] = self[v + h * 4];
+    for (i = 0; i < 11; i++)
+        self[i] = temp[i];
+    self[3] = tx * self[0] + ty * self[1] + tz * self[2];
+    self[7] = tx * self[4] + ty * self[5] + tz * self[6];
+    self[11] = tx * self[8] + ty * self[9] + tz * self[10];
+    return self;
+}
+
+
+// Triangle intersection using barycentric coord method
+function Triangle(p1, p2, p3) {
+    var edge1 = sub(p3, p1);
+    var edge2 = sub(p2, p1);
+    var normal = cross(edge1, edge2);
+    if (Math.abs(normal[0]) > Math.abs(normal[1]))
+        if (Math.abs(normal[0]) > Math.abs(normal[2]))
+            this.axis = 0; 
+        else 
+            this.axis = 2;
+    else
+        if (Math.abs(normal[1]) > Math.abs(normal[2])) 
+            this.axis = 1;
+        else 
+            this.axis = 2;
+    var u = (this.axis + 1) % 3;
+    var v = (this.axis + 2) % 3;
+    var u1 = edge1[u];
+    var v1 = edge1[v];
+    
+    var u2 = edge2[u];
+    var v2 = edge2[v];
+    this.normal = normalise(normal);
+    this.nu = normal[u] / normal[this.axis];
+    this.nv = normal[v] / normal[this.axis];
+    this.nd = dot(normal, p1) / normal[this.axis];
+    var det = u1 * v2 - v1 * u2;
+    this.eu = p1[u];
+    this.ev = p1[v]; 
+    this.nu1 = u1 / det;
+    this.nv1 = -v1 / det;
+    this.nu2 = v2 / det;
+    this.nv2 = -u2 / det; 
+    this.material = [0.7, 0.7, 0.7];
+}
+
+Triangle.prototype.intersect = function(orig, dir, near, far) {
+    var u = (this.axis + 1) % 3;
+    var v = (this.axis + 2) % 3;
+    var d = dir[this.axis] + this.nu * dir[u] + this.nv * dir[v];
+    var t = (this.nd - orig[this.axis] - this.nu * orig[u] - this.nv * orig[v]) / d;
+    if (t < near || t > far)
+        return null;
+    var Pu = orig[u] + t * dir[u] - this.eu;
+    var Pv = orig[v] + t * dir[v] - this.ev;
+    var a2 = Pv * this.nu1 + Pu * this.nv1;
+    if (a2 < 0) 
+        return null;
+    var a3 = Pu * this.nu2 + Pv * this.nv2;
+    if (a3 < 0) 
+        return null;
+
+    if ((a2 + a3) > 1) 
+        return null;
+    return t;
+}
+
+function Scene(a_triangles) {
+    this.triangles = a_triangles;
+    this.lights = [];
+    this.ambient = [0,0,0];
+    this.background = [0.8,0.8,1];
+}
+var zero = new Array(0,0,0);
+
+Scene.prototype.intersect = function(origin, dir, near, far) {
+    var closest = null;
+    for (i = 0; i < this.triangles.length; i++) {
+        var triangle = this.triangles[i];   
+        var d = triangle.intersect(origin, dir, near, far);
+        if (d == null || d > far || d < near)
+            continue;
+        far = d;
+        closest = triangle;
+    }
+    
+    if (!closest)
+        return [this.background[0],this.background[1],this.background[2]];
+        
+    var normal = closest.normal;
+    var hit = add(origin, scale(dir, far)); 
+    if (dot(dir, normal) > 0)
+        normal = [-normal[0], -normal[1], -normal[2]];
+    
+    var colour = null;
+    if (closest.shader) {
+        colour = closest.shader(closest, hit, dir);
+    } else {
+        colour = closest.material;
+    }
+    
+    // do reflection
+    var reflected = null;
+    if (colour.reflection > 0.001) {
+        var reflection = addVector(scale(normal, -2*dot(dir, normal)), dir);
+        reflected = this.intersect(hit, reflection, 0.0001, 1000000);
+        if (colour.reflection >= 0.999999)
+            return reflected;
+    }
+    
+    var l = [this.ambient[0], this.ambient[1], this.ambient[2]];
+    for (var i = 0; i < this.lights.length; i++) {
+        var light = this.lights[i];
+        var toLight = sub(light, hit);
+        var distance = lengthVector(toLight);
+        scaleVector(toLight, 1.0/distance);
+        distance -= 0.0001;
+        if (this.blocked(hit, toLight, distance))
+            continue;
+        var nl = dot(normal, toLight);
+        if (nl > 0)
+            addVector(l, scale(light.colour, nl));
+    }
+    l = scalev(l, colour);
+    if (reflected) {
+        l = addVector(scaleVector(l, 1 - colour.reflection), scaleVector(reflected, colour.reflection));
+    }
+    return l;
+}
+
+Scene.prototype.blocked = function(O, D, far) {
+    var near = 0.0001;
+    var closest = null;
+    for (i = 0; i < this.triangles.length; i++) {
+        var triangle = this.triangles[i];   
+        var d = triangle.intersect(O, D, near, far);
+        if (d == null || d > far || d < near)
+            continue;
+        return true;
+    }
+    
+    return false;
+}
+
+
+// this camera code is from notes i made ages ago, it is from *somewhere* -- i cannot remember where
+// that somewhere is
+function Camera(origin, lookat, up) {
+    var zaxis = normaliseVector(subVector(lookat, origin));
+    var xaxis = normaliseVector(cross(up, zaxis));
+    var yaxis = normaliseVector(cross(xaxis, subVector([0,0,0], zaxis)));
+    var m = new Array(16);
+    m[0] = xaxis[0]; m[1] = xaxis[1]; m[2] = xaxis[2];
+    m[4] = yaxis[0]; m[5] = yaxis[1]; m[6] = yaxis[2];
+    m[8] = zaxis[0]; m[9] = zaxis[1]; m[10] = zaxis[2];
+    invertMatrix(m);
+    m[3] = 0; m[7] = 0; m[11] = 0;
+    this.origin = origin;
+    this.directions = new Array(4);
+    this.directions[0] = normalise([-0.7,  0.7, 1]);
+    this.directions[1] = normalise([ 0.7,  0.7, 1]);
+    this.directions[2] = normalise([ 0.7, -0.7, 1]);
+    this.directions[3] = normalise([-0.7, -0.7, 1]);
+    this.directions[0] = transformMatrix(m, this.directions[0]);
+    this.directions[1] = transformMatrix(m, this.directions[1]);
+    this.directions[2] = transformMatrix(m, this.directions[2]);
+    this.directions[3] = transformMatrix(m, this.directions[3]);
+}
+
+Camera.prototype.generateRayPair = function(y) {
+    rays = new Array(new Object(), new Object());
+    rays[0].origin = this.origin;
+    rays[1].origin = this.origin;
+    rays[0].dir = addVector(scale(this.directions[0], y), scale(this.directions[3], 1 - y));
+    rays[1].dir = addVector(scale(this.directions[1], y), scale(this.directions[2], 1 - y));
+    return rays;
+}
+
+function renderRows(camera, scene, pixels, width, height, starty, stopy) {
+    for (var y = starty; y < stopy; y++) {
+        var rays = camera.generateRayPair(y / height);
+        for (var x = 0; x < width; x++) {
+            var xp = x / width;
+            var origin = addVector(scale(rays[0].origin, xp), scale(rays[1].origin, 1 - xp));
+            var dir = normaliseVector(addVector(scale(rays[0].dir, xp), scale(rays[1].dir, 1 - xp)));
+            var l = scene.intersect(origin, dir);
+            pixels[y][x] = l;
+        }
+    }
+}
+
+Camera.prototype.render = function(scene, pixels, width, height) {
+    var cam = this;
+    var row = 0;
+    renderRows(cam, scene, pixels, width, height, 0, height);
+}
+
+
+
+function raytraceScene()
+{
+    var startDate = new Date().getTime();
+    var numTriangles = 2 * 6;
+    var triangles = new Array();//numTriangles);
+    var tfl = createVector(-10,  10, -10);
+    var tfr = createVector( 10,  10, -10);
+    var tbl = createVector(-10,  10,  10);
+    var tbr = createVector( 10,  10,  10);
+    var bfl = createVector(-10, -10, -10);
+    var bfr = createVector( 10, -10, -10);
+    var bbl = createVector(-10, -10,  10);
+    var bbr = createVector( 10, -10,  10);
+    
+    // cube!!!
+    // front
+    var i = 0;
+    
+    triangles[i++] = new Triangle(tfl, tfr, bfr);
+    triangles[i++] = new Triangle(tfl, bfr, bfl);
+    // back
+    triangles[i++] = new Triangle(tbl, tbr, bbr);
+    triangles[i++] = new Triangle(tbl, bbr, bbl);
+    //        triangles[i-1].material = [0.7,0.2,0.2];
+    //            triangles[i-1].material.reflection = 0.8;
+    // left
+    triangles[i++] = new Triangle(tbl, tfl, bbl);
+    //            triangles[i-1].reflection = 0.6;
+    triangles[i++] = new Triangle(tfl, bfl, bbl);
+    //            triangles[i-1].reflection = 0.6;
+    // right
+    triangles[i++] = new Triangle(tbr, tfr, bbr);
+    triangles[i++] = new Triangle(tfr, bfr, bbr);
+    // top
+    triangles[i++] = new Triangle(tbl, tbr, tfr);
+    triangles[i++] = new Triangle(tbl, tfr, tfl);
+    // bottom
+    triangles[i++] = new Triangle(bbl, bbr, bfr);
+    triangles[i++] = new Triangle(bbl, bfr, bfl);
+    
+    //Floor!!!!
+    var green = createVector(0.0, 0.4, 0.0);
+    var grey = createVector(0.4, 0.4, 0.4);
+    grey.reflection = 1.0;
+    var floorShader = function(tri, pos, view) {
+        var x = ((pos[0]/32) % 2 + 2) % 2;
+        var z = ((pos[2]/32 + 0.3) % 2 + 2) % 2;
+        if (x < 1 != z < 1) {
+            //in the real world we use the fresnel term...
+            //    var angle = 1-dot(view, tri.normal);
+            //   angle *= angle;
+            //  angle *= angle;
+            // angle *= angle;
+            //grey.reflection = angle;
+            return grey;
+        } else 
+            return green;
+    }
+    var ffl = createVector(-1000, -30, -1000);
+    var ffr = createVector( 1000, -30, -1000);
+    var fbl = createVector(-1000, -30,  1000);
+    var fbr = createVector( 1000, -30,  1000);
+    triangles[i++] = new Triangle(fbl, fbr, ffr);
+    triangles[i-1].shader = floorShader;
+    triangles[i++] = new Triangle(fbl, ffr, ffl);
+    triangles[i-1].shader = floorShader;
+    
+    var _scene = new Scene(triangles);
+    _scene.lights[0] = createVector(20, 38, -22);
+    _scene.lights[0].colour = createVector(0.7, 0.3, 0.3);
+    _scene.lights[1] = createVector(-23, 40, 17);
+    _scene.lights[1].colour = createVector(0.7, 0.3, 0.3);
+    _scene.lights[2] = createVector(23, 20, 17);
+    _scene.lights[2].colour = createVector(0.7, 0.7, 0.7);
+    _scene.ambient = createVector(0.1, 0.1, 0.1);
+    //  _scene.background = createVector(0.7, 0.7, 1.0);
+    
+    var size = 30;
+    var pixels = new Array();
+    for (var y = 0; y < size; y++) {
+        pixels[y] = new Array();
+        for (var x = 0; x < size; x++) {
+            pixels[y][x] = 0;
+        }
+    }
+
+    var _camera = new Camera(createVector(-40, 40, 40), createVector(0, 0, 0), createVector(0, 1, 0));
+    _camera.render(_scene, pixels, size, size);
+
+    return pixels;
+}
+
+function arrayToCanvasCommands(pixels)
+{
+    var s = '<canvas id="renderCanvas" width="30px" height="30px"></canvas><scr' + 'ipt>\nvar pixels = [';
+    var size = 30;
+    for (var y = 0; y < size; y++) {
+        s += "[";
+        for (var x = 0; x < size; x++) {
+            s += "[" + pixels[y][x] + "],";
+        }
+        s+= "],";
+    }
+    s += '];\n    var canvas = document.getElementById("renderCanvas").getContext("2d");\n\
+\n\
+\n\
+    var size = 30;\n\
+    canvas.fillStyle = "red";\n\
+    canvas.fillRect(0, 0, size, size);\n\
+    canvas.scale(1, -1);\n\
+    canvas.translate(0, -size);\n\
+\n\
+    if (!canvas.setFillColor)\n\
+        canvas.setFillColor = function(r, g, b, a) {\n\
+            this.fillStyle = "rgb("+[Math.floor(r * 255), Math.floor(g * 255), Math.floor(b * 255)]+")";\n\
+    }\n\
+\n\
+for (var y = 0; y < size; y++) {\n\
+  for (var x = 0; x < size; x++) {\n\
+    var l = pixels[y][x];\n\
+    canvas.setFillColor(l[0], l[1], l[2], 1);\n\
+    canvas.fillRect(x, y, 1, 1);\n\
+  }\n\
+}</scr' + 'ipt>';
+
+    return s;
+}
+
+for (var __i = 0; __i < 300; ++__i) {
+    testOutput = arrayToCanvasCommands(raytraceScene());
+    
+    var expectedLength = 20970;
+    
+    if (testOutput.length != expectedLength)
+        throw "Error: bad result: expected length " + expectedLength + " but got " + testOutput.length;
+}
+
+
diff --git a/PerformanceTests/LongSpider/access-binary-trees.js b/PerformanceTests/LongSpider/access-binary-trees.js
new file mode 100644
index 0000000..9d47815
--- /dev/null
+++ b/PerformanceTests/LongSpider/access-binary-trees.js
@@ -0,0 +1,54 @@
+/* The Great Computer Language Shootout
+   http://shootout.alioth.debian.org/
+   contributed by Isaac Gouy */
+
+function TreeNode(left,right,item){
+   this.left = left;
+   this.right = right;
+   this.item = item;
+}
+
+TreeNode.prototype.itemCheck = function(){
+   if (this.left==null) return this.item;
+   else return this.item + this.left.itemCheck() - this.right.itemCheck();
+}
+
+function bottomUpTree(item,depth){
+   if (depth>0){
+      return new TreeNode(
+          bottomUpTree(2*item-1, depth-1)
+         ,bottomUpTree(2*item, depth-1)
+         ,item
+      );
+   }
+   else {
+      return new TreeNode(null,null,item);
+   }
+}
+
+var ret = 0;
+
+for ( var n = 4; n <= 16; n += 1 ) {
+    var minDepth = 4;
+    var maxDepth = Math.max(minDepth + 2, n);
+    var stretchDepth = maxDepth + 1;
+    
+    var check = bottomUpTree(0,stretchDepth).itemCheck();
+    
+    var longLivedTree = bottomUpTree(0,maxDepth);
+    for (var depth=minDepth; depth<=maxDepth; depth+=2){
+        var iterations = 1 << (maxDepth - depth + minDepth);
+
+        check = 0;
+        for (var i=1; i<=iterations; i++){
+            check += bottomUpTree(i,depth).itemCheck();
+            check += bottomUpTree(-i,depth).itemCheck();
+        }
+    }
+
+    ret += longLivedTree.itemCheck();
+}
+
+var expected = -13;
+if (ret != expected)
+    throw "ERROR: bad result: expected " + expected + " but got " + ret;
diff --git a/PerformanceTests/LongSpider/access-fannkuch.js b/PerformanceTests/LongSpider/access-fannkuch.js
new file mode 100644
index 0000000..0fb0f47
--- /dev/null
+++ b/PerformanceTests/LongSpider/access-fannkuch.js
@@ -0,0 +1,70 @@
+/* The Great Computer Language Shootout
+   http://shootout.alioth.debian.org/
+   contributed by Isaac Gouy */
+
+function fannkuch(n) {
+   var check = 0;
+   var perm = Array(n);
+   var perm1 = Array(n);
+   var count = Array(n);
+   var maxPerm = Array(n);
+   var maxFlipsCount = 0;
+   var m = n - 1;
+
+   for (var i = 0; i < n; i++) perm1[i] = i;
+   var r = n;
+
+   while (true) {
+      // write-out the first 30 permutations
+      if (check < 30){
+         var s = "";
+         for(var i=0; i<n; i++) s += (perm1[i]+1).toString();
+         check++;
+      }
+
+      while (r != 1) { count[r - 1] = r; r--; }
+      if (!(perm1[0] == 0 || perm1[m] == m)) {
+         for (var i = 0; i < n; i++) perm[i] = perm1[i];
+
+         var flipsCount = 0;
+         var k;
+
+         while (!((k = perm[0]) == 0)) {
+            var k2 = (k + 1) >> 1;
+            for (var i = 0; i < k2; i++) {
+               var temp = perm[i]; perm[i] = perm[k - i]; perm[k - i] = temp;
+            }
+            flipsCount++;
+         }
+
+         if (flipsCount > maxFlipsCount) {
+            maxFlipsCount = flipsCount;
+            for (var i = 0; i < n; i++) maxPerm[i] = perm1[i];
+         }
+      }
+
+      while (true) {
+         if (r == n) return maxFlipsCount;
+         var perm0 = perm1[0];
+         var i = 0;
+         while (i < r) {
+            var j = i + 1;
+            perm1[i] = perm1[j];
+            i = j;
+         }
+         perm1[r] = perm0;
+
+         count[r] = count[r] - 1;
+         if (count[r] > 0) break;
+         r++;
+      }
+   }
+}
+
+var n = 10;
+var ret = fannkuch(n);
+
+var expected = 38;
+if (ret != expected)
+    throw "ERROR: bad result: expected " + expected + " but got " + ret;
+
diff --git a/PerformanceTests/LongSpider/access-nbody.js b/PerformanceTests/LongSpider/access-nbody.js
new file mode 100644
index 0000000..de3f6fe
--- /dev/null
+++ b/PerformanceTests/LongSpider/access-nbody.js
@@ -0,0 +1,174 @@
+/* The Great Computer Language Shootout
+   http://shootout.alioth.debian.org/
+   contributed by Isaac Gouy */
+
+var PI = 3.141592653589793;
+var SOLAR_MASS = 4 * PI * PI;
+var DAYS_PER_YEAR = 365.24;
+
+function Body(x,y,z,vx,vy,vz,mass){
+   this.x = x;
+   this.y = y;
+   this.z = z;
+   this.vx = vx;
+   this.vy = vy;
+   this.vz = vz;
+   this.mass = mass;
+}
+
+Body.prototype.offsetMomentum = function(px,py,pz) {
+   this.vx = -px / SOLAR_MASS;
+   this.vy = -py / SOLAR_MASS;
+   this.vz = -pz / SOLAR_MASS;
+   return this;
+}
+
+function Jupiter(){
+   return new Body(
+      4.84143144246472090e+00,
+      -1.16032004402742839e+00,
+      -1.03622044471123109e-01,
+      1.66007664274403694e-03 * DAYS_PER_YEAR,
+      7.69901118419740425e-03 * DAYS_PER_YEAR,
+      -6.90460016972063023e-05 * DAYS_PER_YEAR,
+      9.54791938424326609e-04 * SOLAR_MASS
+   );
+}
+
+function Saturn(){
+   return new Body(
+      8.34336671824457987e+00,
+      4.12479856412430479e+00,
+      -4.03523417114321381e-01,
+      -2.76742510726862411e-03 * DAYS_PER_YEAR,
+      4.99852801234917238e-03 * DAYS_PER_YEAR,
+      2.30417297573763929e-05 * DAYS_PER_YEAR,
+      2.85885980666130812e-04 * SOLAR_MASS
+   );
+}
+
+function Uranus(){
+   return new Body(
+      1.28943695621391310e+01,
+      -1.51111514016986312e+01,
+      -2.23307578892655734e-01,
+      2.96460137564761618e-03 * DAYS_PER_YEAR,
+      2.37847173959480950e-03 * DAYS_PER_YEAR,
+      -2.96589568540237556e-05 * DAYS_PER_YEAR,
+      4.36624404335156298e-05 * SOLAR_MASS
+   );
+}
+
+function Neptune(){
+   return new Body(
+      1.53796971148509165e+01,
+      -2.59193146099879641e+01,
+      1.79258772950371181e-01,
+      2.68067772490389322e-03 * DAYS_PER_YEAR,
+      1.62824170038242295e-03 * DAYS_PER_YEAR,
+      -9.51592254519715870e-05 * DAYS_PER_YEAR,
+      5.15138902046611451e-05 * SOLAR_MASS
+   );
+}
+
+function Sun(){
+   return new Body(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, SOLAR_MASS);
+}
+
+
+function NBodySystem(bodies){
+   this.bodies = bodies;
+   var px = 0.0;
+   var py = 0.0;
+   var pz = 0.0;
+   var size = this.bodies.length;
+   for (var i=0; i<size; i++){
+      var b = this.bodies[i];
+      var m = b.mass;
+      px += b.vx * m;
+      py += b.vy * m;
+      pz += b.vz * m;
+   }
+   this.bodies[0].offsetMomentum(px,py,pz);
+}
+
+NBodySystem.prototype.advance = function(dt){
+   var dx, dy, dz, distance, mag;
+   var size = this.bodies.length;
+
+   for (var i=0; i<size; i++) {
+      var bodyi = this.bodies[i];
+      for (var j=i+1; j<size; j++) {
+         var bodyj = this.bodies[j];
+         dx = bodyi.x - bodyj.x;
+         dy = bodyi.y - bodyj.y;
+         dz = bodyi.z - bodyj.z;
+
+         distance = Math.sqrt(dx*dx + dy*dy + dz*dz);
+         mag = dt / (distance * distance * distance);
+
+         bodyi.vx -= dx * bodyj.mass * mag;
+         bodyi.vy -= dy * bodyj.mass * mag;
+         bodyi.vz -= dz * bodyj.mass * mag;
+
+         bodyj.vx += dx * bodyi.mass * mag;
+         bodyj.vy += dy * bodyi.mass * mag;
+         bodyj.vz += dz * bodyi.mass * mag;
+      }
+   }
+
+   for (var i=0; i<size; i++) {
+      var body = this.bodies[i];
+      body.x += dt * body.vx;
+      body.y += dt * body.vy;
+      body.z += dt * body.vz;
+   }
+}
+
+NBodySystem.prototype.energy = function(){
+   var dx, dy, dz, distance;
+   var e = 0.0;
+   var size = this.bodies.length;
+
+   for (var i=0; i<size; i++) {
+      var bodyi = this.bodies[i];
+
+      e += 0.5 * bodyi.mass *
+         ( bodyi.vx * bodyi.vx
+         + bodyi.vy * bodyi.vy
+         + bodyi.vz * bodyi.vz );
+
+      for (var j=i+1; j<size; j++) {
+         var bodyj = this.bodies[j];
+         dx = bodyi.x - bodyj.x;
+         dy = bodyi.y - bodyj.y;
+         dz = bodyi.z - bodyj.z;
+
+         distance = Math.sqrt(dx*dx + dy*dy + dz*dz);
+         e -= (bodyi.mass * bodyj.mass) / distance;
+      }
+   }
+   return e;
+}
+
+var ret = 0;
+
+for ( var n = 3; n <= 12288; n *= 2 ) {
+    (function(){
+        var bodies = new NBodySystem( Array(
+           Sun(),Jupiter(),Saturn(),Uranus(),Neptune()
+        ));
+        var max = n * 100;
+        
+        ret += bodies.energy();
+        for (var i=0; i<max; i++){
+            bodies.advance(0.01);
+        }
+        ret += bodies.energy();
+    })();
+}
+
+var expected = -4.395717154909567;
+if (ret != expected)
+    throw "ERROR: bad result: expected " + expected + " but got " + ret;
+
diff --git a/PerformanceTests/LongSpider/access-nsieve.js b/PerformanceTests/LongSpider/access-nsieve.js
new file mode 100644
index 0000000..c6b7bac
--- /dev/null
+++ b/PerformanceTests/LongSpider/access-nsieve.js
@@ -0,0 +1,46 @@
+// The Great Computer Language Shootout
+// http://shootout.alioth.debian.org/
+//
+// modified by Isaac Gouy
+
+function pad(number,width){
+   var s = number.toString();
+   var prefixWidth = width - s.length;
+   if (prefixWidth>0){
+      for (var i=1; i<=prefixWidth; i++) s = " " + s;
+   }
+   return s;
+}
+
+function nsieve(m, isPrime){
+   var i, k, count;
+
+   for (i=2; i<=m; i++) { isPrime[i] = true; }
+   count = 0;
+
+   for (i=2; i<=m; i++){
+      if (isPrime[i]) {
+         for (k=i+i; k<=m; k+=i) isPrime[k] = false;
+         count++;
+      }
+   }
+   return count;
+}
+
+function sieve() {
+    var sum = 0;
+    for (var i = 1; i <= 10; i++ ) {
+        var m = (1<<i)*10000;
+        var flags = Array(m+1);
+        sum += nsieve(m, flags);
+    }
+    return sum;
+}
+
+var result = sieve();
+
+var expected = 1430116;
+if (result != expected)
+    throw "ERROR: bad result: expected " + expected + " but got " + result;
+
+
diff --git a/PerformanceTests/LongSpider/bitops-3bit-bits-in-byte.js b/PerformanceTests/LongSpider/bitops-3bit-bits-in-byte.js
new file mode 100644
index 0000000..6dca434
--- /dev/null
+++ b/PerformanceTests/LongSpider/bitops-3bit-bits-in-byte.js
@@ -0,0 +1,40 @@
+// Copyright (c) 2004 by Arthur Langereis (arthur_ext at domain xfinitegames, tld com
+
+var result = 0;
+
+// 1 op = 6 ANDs, 3 SHRs, 3 SHLs, 4 assigns, 2 ADDs
+// O(1)
+function fast3bitlookup(b) {
+var c, bi3b = 0xE994; // 0b1110 1001 1001 0100; // 3 2 2 1  2 1 1 0
+c  = 3 & (bi3b >> ((b << 1) & 14));
+c += 3 & (bi3b >> ((b >> 2) & 14));
+c += 3 & (bi3b >> ((b >> 5) & 6));
+return c;
+
+/*
+lir4,0xE994; 9 instructions, no memory access, minimal register dependence, 6 shifts, 2 adds, 1 inline assign
+rlwinmr5,r3,1,28,30
+rlwinmr6,r3,30,28,30
+rlwinmr7,r3,27,29,30
+rlwnmr8,r4,r5,30,31
+rlwnmr9,r4,r6,30,31
+rlwnmr10,r4,r7,30,31
+addr3,r8,r9
+addr3,r3,r10
+*/
+}
+
+
+function TimeFunc(func) {
+var x, y, t;
+var sum = 0;
+for(var x=0; x<50000; x++)
+for(var y=0; y<256; y++) sum += func(y);
+return sum;
+}
+
+sum = TimeFunc(fast3bitlookup);
+
+var expected = 51200000;
+if (sum != expected)
+    throw "ERROR: bad result: expected " + expected + " but got " + sum;
diff --git a/PerformanceTests/LongSpider/bitops-bits-in-byte.js b/PerformanceTests/LongSpider/bitops-bits-in-byte.js
new file mode 100644
index 0000000..75711eb
--- /dev/null
+++ b/PerformanceTests/LongSpider/bitops-bits-in-byte.js
@@ -0,0 +1,30 @@
+// Copyright (c) 2004 by Arthur Langereis (arthur_ext at domain xfinitegames, tld com)
+
+
+var result = 0;
+
+// 1 op = 2 assigns, 16 compare/branches, 8 ANDs, (0-8) ADDs, 8 SHLs
+// O(n)
+function bitsinbyte(b) {
+var m = 1, c = 0;
+while(m<0x100) {
+if(b & m) c++;
+m <<= 1;
+}
+return c;
+}
+
+function TimeFunc(func) {
+var x, y, t;
+var sum = 0;
+for(var x=0; x<35000; x++)
+for(var y=0; y<256; y++) sum += func(y);
+return sum;
+}
+
+result = TimeFunc(bitsinbyte);
+
+var expected = 35840000;
+if (result != expected)
+    throw "ERROR: bad result: expected " + expected + " but got " + result;
+
diff --git a/PerformanceTests/LongSpider/bitops-nsieve-bits.js b/PerformanceTests/LongSpider/bitops-nsieve-bits.js
new file mode 100644
index 0000000..547d2d5
--- /dev/null
+++ b/PerformanceTests/LongSpider/bitops-nsieve-bits.js
@@ -0,0 +1,42 @@
+// The Great Computer Language Shootout
+//  http://shootout.alioth.debian.org
+//
+//  Contributed by Ian Osgood
+
+function pad(n,width) {
+  var s = n.toString();
+  while (s.length < width) s = ' ' + s;
+  return s;
+}
+
+function primes(isPrime, n) {
+  var i, count = 0, m = 10000<<n, size = m+31>>5;
+
+  for (i=0; i<size; i++) isPrime[i] = 0xffffffff;
+
+  for (i=2; i<m; i++)
+    if (isPrime[i>>5] & 1<<(i&31)) {
+      for (var j=i+i; j<m; j+=i)
+        isPrime[j>>5] &= ~(1<<(j&31));
+      count++;
+    }
+}
+
+function sieve() {
+    for (var i = 4; i <= 11; i++) {
+        var isPrime = new Array((10000<<i)+31>>5);
+        primes(isPrime, i);
+    }
+    return isPrime;
+}
+
+var result = sieve();
+
+var sum = 0;
+for (var i = 0; i < result.length; ++i)
+    sum += result[i];
+
+var expected = -116331605199501;
+if (sum != expected)
+    throw "ERROR: bad result: expected " + expected + " but got " + sum;
+
diff --git a/PerformanceTests/LongSpider/controlflow-recursive.js b/PerformanceTests/LongSpider/controlflow-recursive.js
new file mode 100644
index 0000000..ab92bc6
--- /dev/null
+++ b/PerformanceTests/LongSpider/controlflow-recursive.js
@@ -0,0 +1,32 @@
+// The Computer Language Shootout
+// http://shootout.alioth.debian.org/
+// contributed by Isaac Gouy
+
+function ack(m,n){
+   if (m==0) { return n+1; }
+   if (n==0) { return ack(m-1,1); }
+   return ack(m-1, ack(m,n-1) );
+}
+
+function fib(n) {
+    if (n < 2){ return 1; }
+    return fib(n-2) + fib(n-1);
+}
+
+function tak(x,y,z) {
+    if (y >= x) return z;
+    return tak(tak(x-1,y,z), tak(y-1,z,x), tak(z-1,x,y));
+}
+
+var result = 0;
+
+for ( var i = 3; i <= 9; i++ ) {
+    result += ack(3,i);
+    result += fib(17.0+i);
+    result += tak(3*i+3,2*i+2,i+1);
+}
+
+var expected = 504699;
+if (result != expected)
+    throw "ERROR: bad result: expected " + expected + " but got " + result;
+
diff --git a/PerformanceTests/LongSpider/crypto-aes.js b/PerformanceTests/LongSpider/crypto-aes.js
new file mode 100644
index 0000000..ce1a520
--- /dev/null
+++ b/PerformanceTests/LongSpider/crypto-aes.js
@@ -0,0 +1,429 @@
+/* - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -  */
+
+/*
+ * AES Cipher function: encrypt 'input' with Rijndael algorithm
+ *
+ *   takes   byte-array 'input' (16 bytes)
+ *           2D byte-array key schedule 'w' (Nr+1 x Nb bytes)
+ *
+ *   applies Nr rounds (10/12/14) using key schedule w for 'add round key' stage
+ *
+ *   returns byte-array encrypted value (16 bytes)
+ */
+function Cipher(input, w) {    // main Cipher function [§5.1]
+  var Nb = 4;               // block size (in words): no of columns in state (fixed at 4 for AES)
+  var Nr = w.length/Nb - 1; // no of rounds: 10/12/14 for 128/192/256-bit keys
+
+  var state = [[],[],[],[]];  // initialise 4xNb byte-array 'state' with input [§3.4]
+  for (var i=0; i<4*Nb; i++) state[i%4][Math.floor(i/4)] = input[i];
+
+  state = AddRoundKey(state, w, 0, Nb);
+
+  for (var round=1; round<Nr; round++) {
+    state = SubBytes(state, Nb);
+    state = ShiftRows(state, Nb);
+    state = MixColumns(state, Nb);
+    state = AddRoundKey(state, w, round, Nb);
+  }
+
+  state = SubBytes(state, Nb);
+  state = ShiftRows(state, Nb);
+  state = AddRoundKey(state, w, Nr, Nb);
+
+  var output = new Array(4*Nb);  // convert state to 1-d array before returning [§3.4]
+  for (var i=0; i<4*Nb; i++) output[i] = state[i%4][Math.floor(i/4)];
+  return output;
+}
+
+
+function SubBytes(s, Nb) {    // apply SBox to state S [§5.1.1]
+  for (var r=0; r<4; r++) {
+    for (var c=0; c<Nb; c++) s[r][c] = Sbox[s[r][c]];
+  }
+  return s;
+}
+
+
+function ShiftRows(s, Nb) {    // shift row r of state S left by r bytes [§5.1.2]
+  var t = new Array(4);
+  for (var r=1; r<4; r++) {
+    for (var c=0; c<4; c++) t[c] = s[r][(c+r)%Nb];  // shift into temp copy
+    for (var c=0; c<4; c++) s[r][c] = t[c];         // and copy back
+  }          // note that this will work for Nb=4,5,6, but not 7,8 (always 4 for AES):
+  return s;  // see fp.gladman.plus.com/cryptography_technology/rijndael/aes.spec.311.pdf 
+}
+
+
+function MixColumns(s, Nb) {   // combine bytes of each col of state S [§5.1.3]
+  for (var c=0; c<4; c++) {
+    var a = new Array(4);  // 'a' is a copy of the current column from 's'
+    var b = new Array(4);  // 'b' is a•{02} in GF(2^8)
+    for (var i=0; i<4; i++) {
+      a[i] = s[i][c];
+      b[i] = s[i][c]&0x80 ? s[i][c]<<1 ^ 0x011b : s[i][c]<<1;
+    }
+    // a[n] ^ b[n] is a•{03} in GF(2^8)
+    s[0][c] = b[0] ^ a[1] ^ b[1] ^ a[2] ^ a[3]; // 2*a0 + 3*a1 + a2 + a3
+    s[1][c] = a[0] ^ b[1] ^ a[2] ^ b[2] ^ a[3]; // a0 * 2*a1 + 3*a2 + a3
+    s[2][c] = a[0] ^ a[1] ^ b[2] ^ a[3] ^ b[3]; // a0 + a1 + 2*a2 + 3*a3
+    s[3][c] = a[0] ^ b[0] ^ a[1] ^ a[2] ^ b[3]; // 3*a0 + a1 + a2 + 2*a3
+  }
+  return s;
+}
+
+
+function AddRoundKey(state, w, rnd, Nb) {  // xor Round Key into state S [§5.1.4]
+  for (var r=0; r<4; r++) {
+    for (var c=0; c<Nb; c++) state[r][c] ^= w[rnd*4+c][r];
+  }
+  return state;
+}
+
+
+function KeyExpansion(key) {  // generate Key Schedule (byte-array Nr+1 x Nb) from Key [§5.2]
+  var Nb = 4;            // block size (in words): no of columns in state (fixed at 4 for AES)
+  var Nk = key.length/4  // key length (in words): 4/6/8 for 128/192/256-bit keys
+  var Nr = Nk + 6;       // no of rounds: 10/12/14 for 128/192/256-bit keys
+
+  var w = new Array(Nb*(Nr+1));
+  var temp = new Array(4);
+
+  for (var i=0; i<Nk; i++) {
+    var r = [key[4*i], key[4*i+1], key[4*i+2], key[4*i+3]];
+    w[i] = r;
+  }
+
+  for (var i=Nk; i<(Nb*(Nr+1)); i++) {
+    w[i] = new Array(4);
+    for (var t=0; t<4; t++) temp[t] = w[i-1][t];
+    if (i % Nk == 0) {
+      temp = SubWord(RotWord(temp));
+      for (var t=0; t<4; t++) temp[t] ^= Rcon[i/Nk][t];
+    } else if (Nk > 6 && i%Nk == 4) {
+      temp = SubWord(temp);
+    }
+    for (var t=0; t<4; t++) w[i][t] = w[i-Nk][t] ^ temp[t];
+  }
+
+  return w;
+}
+
+function SubWord(w) {    // apply SBox to 4-byte word w
+  for (var i=0; i<4; i++) w[i] = Sbox[w[i]];
+  return w;
+}
+
+function RotWord(w) {    // rotate 4-byte word w left by one byte
+  w[4] = w[0];
+  for (var i=0; i<4; i++) w[i] = w[i+1];
+  return w;
+}
+
+
+// Sbox is pre-computed multiplicative inverse in GF(2^8) used in SubBytes and KeyExpansion [§5.1.1]
+var Sbox =  [0x63,0x7c,0x77,0x7b,0xf2,0x6b,0x6f,0xc5,0x30,0x01,0x67,0x2b,0xfe,0xd7,0xab,0x76,
+             0xca,0x82,0xc9,0x7d,0xfa,0x59,0x47,0xf0,0xad,0xd4,0xa2,0xaf,0x9c,0xa4,0x72,0xc0,
+             0xb7,0xfd,0x93,0x26,0x36,0x3f,0xf7,0xcc,0x34,0xa5,0xe5,0xf1,0x71,0xd8,0x31,0x15,
+             0x04,0xc7,0x23,0xc3,0x18,0x96,0x05,0x9a,0x07,0x12,0x80,0xe2,0xeb,0x27,0xb2,0x75,
+             0x09,0x83,0x2c,0x1a,0x1b,0x6e,0x5a,0xa0,0x52,0x3b,0xd6,0xb3,0x29,0xe3,0x2f,0x84,
+             0x53,0xd1,0x00,0xed,0x20,0xfc,0xb1,0x5b,0x6a,0xcb,0xbe,0x39,0x4a,0x4c,0x58,0xcf,
+             0xd0,0xef,0xaa,0xfb,0x43,0x4d,0x33,0x85,0x45,0xf9,0x02,0x7f,0x50,0x3c,0x9f,0xa8,
+             0x51,0xa3,0x40,0x8f,0x92,0x9d,0x38,0xf5,0xbc,0xb6,0xda,0x21,0x10,0xff,0xf3,0xd2,
+             0xcd,0x0c,0x13,0xec,0x5f,0x97,0x44,0x17,0xc4,0xa7,0x7e,0x3d,0x64,0x5d,0x19,0x73,
+             0x60,0x81,0x4f,0xdc,0x22,0x2a,0x90,0x88,0x46,0xee,0xb8,0x14,0xde,0x5e,0x0b,0xdb,
+             0xe0,0x32,0x3a,0x0a,0x49,0x06,0x24,0x5c,0xc2,0xd3,0xac,0x62,0x91,0x95,0xe4,0x79,
+             0xe7,0xc8,0x37,0x6d,0x8d,0xd5,0x4e,0xa9,0x6c,0x56,0xf4,0xea,0x65,0x7a,0xae,0x08,
+             0xba,0x78,0x25,0x2e,0x1c,0xa6,0xb4,0xc6,0xe8,0xdd,0x74,0x1f,0x4b,0xbd,0x8b,0x8a,
+             0x70,0x3e,0xb5,0x66,0x48,0x03,0xf6,0x0e,0x61,0x35,0x57,0xb9,0x86,0xc1,0x1d,0x9e,
+             0xe1,0xf8,0x98,0x11,0x69,0xd9,0x8e,0x94,0x9b,0x1e,0x87,0xe9,0xce,0x55,0x28,0xdf,
+             0x8c,0xa1,0x89,0x0d,0xbf,0xe6,0x42,0x68,0x41,0x99,0x2d,0x0f,0xb0,0x54,0xbb,0x16];
+
+// Rcon is Round Constant used for the Key Expansion [1st col is 2^(r-1) in GF(2^8)] [§5.2]
+var Rcon = [ [0x00, 0x00, 0x00, 0x00],
+             [0x01, 0x00, 0x00, 0x00],
+             [0x02, 0x00, 0x00, 0x00],
+             [0x04, 0x00, 0x00, 0x00],
+             [0x08, 0x00, 0x00, 0x00],
+             [0x10, 0x00, 0x00, 0x00],
+             [0x20, 0x00, 0x00, 0x00],
+             [0x40, 0x00, 0x00, 0x00],
+             [0x80, 0x00, 0x00, 0x00],
+             [0x1b, 0x00, 0x00, 0x00],
+             [0x36, 0x00, 0x00, 0x00] ]; 
+
+
+/* - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -  */
+
+/* 
+ * Use AES to encrypt 'plaintext' with 'password' using 'nBits' key, in 'Counter' mode of operation
+ *                           - see http://csrc.nist.gov/publications/nistpubs/800-38a/sp800-38a.pdf
+ *   for each block
+ *   - outputblock = cipher(counter, key)
+ *   - cipherblock = plaintext xor outputblock
+ */
+function AESEncryptCtr(plaintext, password, nBits) {
+  if (!(nBits==128 || nBits==192 || nBits==256)) return '';  // standard allows 128/192/256 bit keys
+
+  // for this example script, generate the key by applying Cipher to 1st 16/24/32 chars of password; 
+  // for real-world applications, a more secure approach would be to hash the password e.g. with SHA-1
+  var nBytes = nBits/8;  // no bytes in key
+  var pwBytes = new Array(nBytes);
+  for (var i=0; i<nBytes; i++) pwBytes[i] = password.charCodeAt(i) & 0xff;
+  var key = Cipher(pwBytes, KeyExpansion(pwBytes));
+  key = key.concat(key.slice(0, nBytes-16));  // key is now 16/24/32 bytes long
+
+  // initialise counter block (NIST SP800-38A §B.2): millisecond time-stamp for nonce in 1st 8 bytes,
+  // block counter in 2nd 8 bytes
+  var blockSize = 16;  // block size fixed at 16 bytes / 128 bits (Nb=4) for AES
+  var counterBlock = new Array(blockSize);  // block size fixed at 16 bytes / 128 bits (Nb=4) for AES
+  var nonce = (new Date()).getTime();  // milliseconds since 1-Jan-1970
+
+  // encode nonce in two stages to cater for JavaScript 32-bit limit on bitwise ops
+  for (var i=0; i<4; i++) counterBlock[i] = (nonce >>> i*8) & 0xff;
+  for (var i=0; i<4; i++) counterBlock[i+4] = (nonce/0x100000000 >>> i*8) & 0xff; 
+
+  // generate key schedule - an expansion of the key into distinct Key Rounds for each round
+  var keySchedule = KeyExpansion(key);
+
+  var blockCount = Math.ceil(plaintext.length/blockSize);
+  var ciphertext = new Array(blockCount);  // ciphertext as array of strings
+  
+  for (var b=0; b<blockCount; b++) {
+    // set counter (block #) in last 8 bytes of counter block (leaving nonce in 1st 8 bytes)
+    // again done in two stages for 32-bit ops
+    for (var c=0; c<4; c++) counterBlock[15-c] = (b >>> c*8) & 0xff;
+    for (var c=0; c<4; c++) counterBlock[15-c-4] = (b/0x100000000 >>> c*8)
+
+    var cipherCntr = Cipher(counterBlock, keySchedule);  // -- encrypt counter block --
+    
+    // calculate length of final block:
+    var blockLength = b<blockCount-1 ? blockSize : (plaintext.length-1)%blockSize+1;
+
+    var ct = '';
+    for (var i=0; i<blockLength; i++) {  // -- xor plaintext with ciphered counter byte-by-byte --
+      var plaintextByte = plaintext.charCodeAt(b*blockSize+i);
+      var cipherByte = plaintextByte ^ cipherCntr[i];
+      ct += String.fromCharCode(cipherByte);
+    }
+    // ct is now ciphertext for this block
+
+    ciphertext[b] = escCtrlChars(ct);  // escape troublesome characters in ciphertext
+  }
+
+  // convert the nonce to a string to go on the front of the ciphertext
+  var ctrTxt = '';
+  for (var i=0; i<8; i++) ctrTxt += String.fromCharCode(counterBlock[i]);
+  ctrTxt = escCtrlChars(ctrTxt);
+
+  // use '-' to separate blocks, use Array.join to concatenate arrays of strings for efficiency
+  return ctrTxt + '-' + ciphertext.join('-');
+}
+
+
+/* 
+ * Use AES to decrypt 'ciphertext' with 'password' using 'nBits' key, in Counter mode of operation
+ *
+ *   for each block
+ *   - outputblock = cipher(counter, key)
+ *   - cipherblock = plaintext xor outputblock
+ */
+function AESDecryptCtr(ciphertext, password, nBits) {
+  if (!(nBits==128 || nBits==192 || nBits==256)) return '';  // standard allows 128/192/256 bit keys
+
+  var nBytes = nBits/8;  // no bytes in key
+  var pwBytes = new Array(nBytes);
+  for (var i=0; i<nBytes; i++) pwBytes[i] = password.charCodeAt(i) & 0xff;
+  var pwKeySchedule = KeyExpansion(pwBytes);
+  var key = Cipher(pwBytes, pwKeySchedule);
+  key = key.concat(key.slice(0, nBytes-16));  // key is now 16/24/32 bytes long
+
+  var keySchedule = KeyExpansion(key);
+
+  ciphertext = ciphertext.split('-');  // split ciphertext into array of block-length strings 
+
+  // recover nonce from 1st element of ciphertext
+  var blockSize = 16;  // block size fixed at 16 bytes / 128 bits (Nb=4) for AES
+  var counterBlock = new Array(blockSize);
+  var ctrTxt = unescCtrlChars(ciphertext[0]);
+  for (var i=0; i<8; i++) counterBlock[i] = ctrTxt.charCodeAt(i);
+
+  var plaintext = new Array(ciphertext.length-1);
+
+  for (var b=1; b<ciphertext.length; b++) {
+    // set counter (block #) in last 8 bytes of counter block (leaving nonce in 1st 8 bytes)
+    for (var c=0; c<4; c++) counterBlock[15-c] = ((b-1) >>> c*8) & 0xff;
+    for (var c=0; c<4; c++) counterBlock[15-c-4] = ((b/0x100000000-1) >>> c*8) & 0xff;
+
+    var cipherCntr = Cipher(counterBlock, keySchedule);  // encrypt counter block
+
+    ciphertext[b] = unescCtrlChars(ciphertext[b]);
+
+    var pt = '';
+    for (var i=0; i<ciphertext[b].length; i++) {
+      // -- xor plaintext with ciphered counter byte-by-byte --
+      var ciphertextByte = ciphertext[b].charCodeAt(i);
+      var plaintextByte = ciphertextByte ^ cipherCntr[i];
+      pt += String.fromCharCode(plaintextByte);
+    }
+    // pt is now plaintext for this block
+
+    plaintext[b-1] = pt;  // b-1 'cos no initial nonce block in plaintext
+  }
+
+  return plaintext.join('');
+}
+
+/* - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -  */
+
+function escCtrlChars(str) {  // escape control chars which might cause problems handling ciphertext
+  return str.replace(/[\0\t\n\v\f\r\xa0'"!-]/g, function(c) { return '!' + c.charCodeAt(0) + '!'; });
+}  // \xa0 to cater for bug in Firefox; include '-' to leave it free for use as a block marker
+
+function unescCtrlChars(str) {  // unescape potentially problematic control characters
+  return str.replace(/!\d\d?\d?!/g, function(c) { return String.fromCharCode(c.slice(1,-1)); });
+}
+/* - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -  */
+
+/*
+ * if escCtrlChars()/unescCtrlChars() still gives problems, use encodeBase64()/decodeBase64() instead
+ */
+var b64 = "ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/=";
+
+function encodeBase64(str) {  // http://tools.ietf.org/html/rfc4648
+   var o1, o2, o3, h1, h2, h3, h4, bits, i=0, enc='';
+   
+   str = encodeUTF8(str);  // encode multi-byte chars into UTF-8 for byte-array
+
+   do {  // pack three octets into four hexets
+      o1 = str.charCodeAt(i++);
+      o2 = str.charCodeAt(i++);
+      o3 = str.charCodeAt(i++);
+      
+      bits = o1<<16 | o2<<8 | o3;
+      
+      h1 = bits>>18 & 0x3f;
+      h2 = bits>>12 & 0x3f;
+      h3 = bits>>6 & 0x3f;
+      h4 = bits & 0x3f;
+      
+      // end of string? index to '=' in b64
+      if (isNaN(o3)) h4 = 64;
+      if (isNaN(o2)) h3 = 64;
+      
+      // use hexets to index into b64, and append result to encoded string
+      enc += b64.charAt(h1) + b64.charAt(h2) + b64.charAt(h3) + b64.charAt(h4);
+   } while (i < str.length);
+   
+   return enc;
+}
+
+function decodeBase64(str) {
+   var o1, o2, o3, h1, h2, h3, h4, bits, i=0, enc='';
+
+   do {  // unpack four hexets into three octets using index points in b64
+      h1 = b64.indexOf(str.charAt(i++));
+      h2 = b64.indexOf(str.charAt(i++));
+      h3 = b64.indexOf(str.charAt(i++));
+      h4 = b64.indexOf(str.charAt(i++));
+      
+      bits = h1<<18 | h2<<12 | h3<<6 | h4;
+      
+      o1 = bits>>16 & 0xff;
+      o2 = bits>>8 & 0xff;
+      o3 = bits & 0xff;
+      
+      if (h3 == 64)      enc += String.fromCharCode(o1);
+      else if (h4 == 64) enc += String.fromCharCode(o1, o2);
+      else               enc += String.fromCharCode(o1, o2, o3);
+   } while (i < str.length);
+
+   return decodeUTF8(enc);  // decode UTF-8 byte-array back to Unicode
+}
+
+function encodeUTF8(str) {  // encode multi-byte string into utf-8 multiple single-byte characters 
+  str = str.replace(
+      /[\u0080-\u07ff]/g,  // U+0080 - U+07FF = 2-byte chars
+      function(c) { 
+        var cc = c.charCodeAt(0);
+        return String.fromCharCode(0xc0 | cc>>6, 0x80 | cc&0x3f); }
+    );
+  str = str.replace(
+      /[\u0800-\uffff]/g,  // U+0800 - U+FFFF = 3-byte chars
+      function(c) { 
+        var cc = c.charCodeAt(0); 
+        return String.fromCharCode(0xe0 | cc>>12, 0x80 | cc>>6&0x3F, 0x80 | cc&0x3f); }
+    );
+  return str;
+}
+
+function decodeUTF8(str) {  // decode utf-8 encoded string back into multi-byte characters
+  str = str.replace(
+      /[\u00c0-\u00df][\u0080-\u00bf]/g,                 // 2-byte chars
+      function(c) { 
+        var cc = (c.charCodeAt(0)&0x1f)<<6 | c.charCodeAt(1)&0x3f;
+        return String.fromCharCode(cc); }
+    );
+  str = str.replace(
+      /[\u00e0-\u00ef][\u0080-\u00bf][\u0080-\u00bf]/g,  // 3-byte chars
+      function(c) { 
+        var cc = (c.charCodeAt(0)&0x0f)<<12 | (c.charCodeAt(1)&0x3f<<6) | c.charCodeAt(2)&0x3f; 
+        return String.fromCharCode(cc); }
+    );
+  return str;
+}
+
+
+function byteArrayToHexStr(b) {  // convert byte array to hex string for displaying test vectors
+  var s = '';
+  for (var i=0; i<b.length; i++) s += b[i].toString(16) + ' ';
+  return s;
+}
+
+/* - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -  */
+
+
+var plainText = "ROMEO: But, soft! what light through yonder window breaks?\n\
+It is the east, and Juliet is the sun.\n\
+Arise, fair sun, and kill the envious moon,\n\
+Who is already sick and pale with grief,\n\
+That thou her maid art far more fair than she:\n\
+Be not her maid, since she is envious;\n\
+Her vestal livery is but sick and green\n\
+And none but fools do wear it; cast it off.\n\
+It is my lady, O, it is my love!\n\
+O, that she knew she were!\n\
+She speaks yet she says nothing: what of that?\n\
+Her eye discourses; I will answer it.\n\
+I am too bold, 'tis not to me she speaks:\n\
+Two of the fairest stars in all the heaven,\n\
+Having some business, do entreat her eyes\n\
+To twinkle in their spheres till they return.\n\
+What if her eyes were there, they in her head?\n\
+The brightness of her cheek would shame those stars,\n\
+As daylight doth a lamp; her eyes in heaven\n\
+Would through the airy region stream so bright\n\
+That birds would sing and think it were not night.\n\
+See, how she leans her cheek upon her hand!\n\
+O, that I were a glove upon that hand,\n\
+That I might touch that cheek!\n\
+JULIET: Ay me!\n\
+ROMEO: She speaks:\n\
+O, speak again, bright angel! for thou art\n\
+As glorious to this night, being o'er my head\n\
+As is a winged messenger of heaven\n\
+Unto the white-upturned wondering eyes\n\
+Of mortals that fall back to gaze on him\n\
+When he bestrides the lazy-pacing clouds\n\
+And sails upon the bosom of the air.";
+
+var password = "O Romeo, Romeo! wherefore art thou Romeo?";
+
+for (var i = 0; i < 600; ++i) {
+    var cipherText = AESEncryptCtr(plainText, password, 256);
+    var decryptedText = AESDecryptCtr(cipherText, password, 256);
+    
+    if (decryptedText != plainText)
+        throw "ERROR: bad result: expected " + plainText + " but got " + decryptedText;
+}
+
+
diff --git a/PerformanceTests/LongSpider/crypto-md5.js b/PerformanceTests/LongSpider/crypto-md5.js
new file mode 100644
index 0000000..f4a83cc
--- /dev/null
+++ b/PerformanceTests/LongSpider/crypto-md5.js
@@ -0,0 +1,295 @@
+/*
+ * A JavaScript implementation of the RSA Data Security, Inc. MD5 Message
+ * Digest Algorithm, as defined in RFC 1321.
+ * Version 2.1 Copyright (C) Paul Johnston 1999 - 2002.
+ * Other contributors: Greg Holt, Andrew Kepert, Ydnar, Lostinet
+ * Distributed under the BSD License
+ * See http://pajhome.org.uk/crypt/md5 for more info.
+ */
+
+/*
+ * Configurable variables. You may need to tweak these to be compatible with
+ * the server-side, but the defaults work in most cases.
+ */
+var hexcase = 0;  /* hex output format. 0 - lowercase; 1 - uppercase        */
+var b64pad  = ""; /* base-64 pad character. "=" for strict RFC compliance   */
+var chrsz   = 8;  /* bits per input character. 8 - ASCII; 16 - Unicode      */
+
+/*
+ * These are the functions you'll usually want to call
+ * They take string arguments and return either hex or base-64 encoded strings
+ */
+function hex_md5(s){ return binl2hex(core_md5(str2binl(s), s.length * chrsz));}
+function b64_md5(s){ return binl2b64(core_md5(str2binl(s), s.length * chrsz));}
+function str_md5(s){ return binl2str(core_md5(str2binl(s), s.length * chrsz));}
+function hex_hmac_md5(key, data) { return binl2hex(core_hmac_md5(key, data)); }
+function b64_hmac_md5(key, data) { return binl2b64(core_hmac_md5(key, data)); }
+function str_hmac_md5(key, data) { return binl2str(core_hmac_md5(key, data)); }
+
+/*
+ * Perform a simple self-test to see if the VM is working
+ */
+function md5_vm_test()
+{
+  return hex_md5("abc") == "900150983cd24fb0d6963f7d28e17f72";
+}
+
+/*
+ * Calculate the MD5 of an array of little-endian words, and a bit length
+ */
+function core_md5(x, len)
+{
+  /* append padding */
+  x[len >> 5] |= 0x80 << ((len) % 32);
+  x[(((len + 64) >>> 9) << 4) + 14] = len;
+
+  var a =  1732584193;
+  var b = -271733879;
+  var c = -1732584194;
+  var d =  271733878;
+
+  for(var i = 0; i < x.length; i += 16)
+  {
+    var olda = a;
+    var oldb = b;
+    var oldc = c;
+    var oldd = d;
+
+    a = md5_ff(a, b, c, d, x[i+ 0], 7 , -680876936);
+    d = md5_ff(d, a, b, c, x[i+ 1], 12, -389564586);
+    c = md5_ff(c, d, a, b, x[i+ 2], 17,  606105819);
+    b = md5_ff(b, c, d, a, x[i+ 3], 22, -1044525330);
+    a = md5_ff(a, b, c, d, x[i+ 4], 7 , -176418897);
+    d = md5_ff(d, a, b, c, x[i+ 5], 12,  1200080426);
+    c = md5_ff(c, d, a, b, x[i+ 6], 17, -1473231341);
+    b = md5_ff(b, c, d, a, x[i+ 7], 22, -45705983);
+    a = md5_ff(a, b, c, d, x[i+ 8], 7 ,  1770035416);
+    d = md5_ff(d, a, b, c, x[i+ 9], 12, -1958414417);
+    c = md5_ff(c, d, a, b, x[i+10], 17, -42063);
+    b = md5_ff(b, c, d, a, x[i+11], 22, -1990404162);
+    a = md5_ff(a, b, c, d, x[i+12], 7 ,  1804603682);
+    d = md5_ff(d, a, b, c, x[i+13], 12, -40341101);
+    c = md5_ff(c, d, a, b, x[i+14], 17, -1502002290);
+    b = md5_ff(b, c, d, a, x[i+15], 22,  1236535329);
+
+    a = md5_gg(a, b, c, d, x[i+ 1], 5 , -165796510);
+    d = md5_gg(d, a, b, c, x[i+ 6], 9 , -1069501632);
+    c = md5_gg(c, d, a, b, x[i+11], 14,  643717713);
+    b = md5_gg(b, c, d, a, x[i+ 0], 20, -373897302);
+    a = md5_gg(a, b, c, d, x[i+ 5], 5 , -701558691);
+    d = md5_gg(d, a, b, c, x[i+10], 9 ,  38016083);
+    c = md5_gg(c, d, a, b, x[i+15], 14, -660478335);
+    b = md5_gg(b, c, d, a, x[i+ 4], 20, -405537848);
+    a = md5_gg(a, b, c, d, x[i+ 9], 5 ,  568446438);
+    d = md5_gg(d, a, b, c, x[i+14], 9 , -1019803690);
+    c = md5_gg(c, d, a, b, x[i+ 3], 14, -187363961);
+    b = md5_gg(b, c, d, a, x[i+ 8], 20,  1163531501);
+    a = md5_gg(a, b, c, d, x[i+13], 5 , -1444681467);
+    d = md5_gg(d, a, b, c, x[i+ 2], 9 , -51403784);
+    c = md5_gg(c, d, a, b, x[i+ 7], 14,  1735328473);
+    b = md5_gg(b, c, d, a, x[i+12], 20, -1926607734);
+
+    a = md5_hh(a, b, c, d, x[i+ 5], 4 , -378558);
+    d = md5_hh(d, a, b, c, x[i+ 8], 11, -2022574463);
+    c = md5_hh(c, d, a, b, x[i+11], 16,  1839030562);
+    b = md5_hh(b, c, d, a, x[i+14], 23, -35309556);
+    a = md5_hh(a, b, c, d, x[i+ 1], 4 , -1530992060);
+    d = md5_hh(d, a, b, c, x[i+ 4], 11,  1272893353);
+    c = md5_hh(c, d, a, b, x[i+ 7], 16, -155497632);
+    b = md5_hh(b, c, d, a, x[i+10], 23, -1094730640);
+    a = md5_hh(a, b, c, d, x[i+13], 4 ,  681279174);
+    d = md5_hh(d, a, b, c, x[i+ 0], 11, -358537222);
+    c = md5_hh(c, d, a, b, x[i+ 3], 16, -722521979);
+    b = md5_hh(b, c, d, a, x[i+ 6], 23,  76029189);
+    a = md5_hh(a, b, c, d, x[i+ 9], 4 , -640364487);
+    d = md5_hh(d, a, b, c, x[i+12], 11, -421815835);
+    c = md5_hh(c, d, a, b, x[i+15], 16,  530742520);
+    b = md5_hh(b, c, d, a, x[i+ 2], 23, -995338651);
+
+    a = md5_ii(a, b, c, d, x[i+ 0], 6 , -198630844);
+    d = md5_ii(d, a, b, c, x[i+ 7], 10,  1126891415);
+    c = md5_ii(c, d, a, b, x[i+14], 15, -1416354905);
+    b = md5_ii(b, c, d, a, x[i+ 5], 21, -57434055);
+    a = md5_ii(a, b, c, d, x[i+12], 6 ,  1700485571);
+    d = md5_ii(d, a, b, c, x[i+ 3], 10, -1894986606);
+    c = md5_ii(c, d, a, b, x[i+10], 15, -1051523);
+    b = md5_ii(b, c, d, a, x[i+ 1], 21, -2054922799);
+    a = md5_ii(a, b, c, d, x[i+ 8], 6 ,  1873313359);
+    d = md5_ii(d, a, b, c, x[i+15], 10, -30611744);
+    c = md5_ii(c, d, a, b, x[i+ 6], 15, -1560198380);
+    b = md5_ii(b, c, d, a, x[i+13], 21,  1309151649);
+    a = md5_ii(a, b, c, d, x[i+ 4], 6 , -145523070);
+    d = md5_ii(d, a, b, c, x[i+11], 10, -1120210379);
+    c = md5_ii(c, d, a, b, x[i+ 2], 15,  718787259);
+    b = md5_ii(b, c, d, a, x[i+ 9], 21, -343485551);
+
+    a = safe_add(a, olda);
+    b = safe_add(b, oldb);
+    c = safe_add(c, oldc);
+    d = safe_add(d, oldd);
+  }
+  return Array(a, b, c, d);
+
+}
+
+/*
+ * These functions implement the four basic operations the algorithm uses.
+ */
+function md5_cmn(q, a, b, x, s, t)
+{
+  return safe_add(bit_rol(safe_add(safe_add(a, q), safe_add(x, t)), s),b);
+}
+function md5_ff(a, b, c, d, x, s, t)
+{
+  return md5_cmn((b & c) | ((~b) & d), a, b, x, s, t);
+}
+function md5_gg(a, b, c, d, x, s, t)
+{
+  return md5_cmn((b & d) | (c & (~d)), a, b, x, s, t);
+}
+function md5_hh(a, b, c, d, x, s, t)
+{
+  return md5_cmn(b ^ c ^ d, a, b, x, s, t);
+}
+function md5_ii(a, b, c, d, x, s, t)
+{
+  return md5_cmn(c ^ (b | (~d)), a, b, x, s, t);
+}
+
+/*
+ * Calculate the HMAC-MD5, of a key and some data
+ */
+function core_hmac_md5(key, data)
+{
+  var bkey = str2binl(key);
+  if(bkey.length > 16) bkey = core_md5(bkey, key.length * chrsz);
+
+  var ipad = Array(16), opad = Array(16);
+  for(var i = 0; i < 16; i++)
+  {
+    ipad[i] = bkey[i] ^ 0x36363636;
+    opad[i] = bkey[i] ^ 0x5C5C5C5C;
+  }
+
+  var hash = core_md5(ipad.concat(str2binl(data)), 512 + data.length * chrsz);
+  return core_md5(opad.concat(hash), 512 + 128);
+}
+
+/*
+ * Add integers, wrapping at 2^32. This uses 16-bit operations internally
+ * to work around bugs in some JS interpreters.
+ */
+function safe_add(x, y)
+{
+  var lsw = (x & 0xFFFF) + (y & 0xFFFF);
+  var msw = (x >> 16) + (y >> 16) + (lsw >> 16);
+  return (msw << 16) | (lsw & 0xFFFF);
+}
+
+/*
+ * Bitwise rotate a 32-bit number to the left.
+ */
+function bit_rol(num, cnt)
+{
+  return (num << cnt) | (num >>> (32 - cnt));
+}
+
+/*
+ * Convert a string to an array of little-endian words
+ * If chrsz is ASCII, characters >255 have their hi-byte silently ignored.
+ */
+function str2binl(str)
+{
+  var bin = Array();
+  var mask = (1 << chrsz) - 1;
+  for(var i = 0; i < str.length * chrsz; i += chrsz)
+    bin[i>>5] |= (str.charCodeAt(i / chrsz) & mask) << (i%32);
+  return bin;
+}
+
+/*
+ * Convert an array of little-endian words to a string
+ */
+function binl2str(bin)
+{
+  var str = "";
+  var mask = (1 << chrsz) - 1;
+  for(var i = 0; i < bin.length * 32; i += chrsz)
+    str += String.fromCharCode((bin[i>>5] >>> (i % 32)) & mask);
+  return str;
+}
+
+/*
+ * Convert an array of little-endian words to a hex string.
+ */
+function binl2hex(binarray)
+{
+  var hex_tab = hexcase ? "0123456789ABCDEF" : "0123456789abcdef";
+  var str = "";
+  for(var i = 0; i < binarray.length * 4; i++)
+  {
+    str += hex_tab.charAt((binarray[i>>2] >> ((i%4)*8+4)) & 0xF) +
+           hex_tab.charAt((binarray[i>>2] >> ((i%4)*8  )) & 0xF);
+  }
+  return str;
+}
+
+/*
+ * Convert an array of little-endian words to a base-64 string
+ */
+function binl2b64(binarray)
+{
+  var tab = "ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/";
+  var str = "";
+  for(var i = 0; i < binarray.length * 4; i += 3)
+  {
+    var triplet = (((binarray[i   >> 2] >> 8 * ( i   %4)) & 0xFF) << 16)
+                | (((binarray[i+1 >> 2] >> 8 * ((i+1)%4)) & 0xFF) << 8 )
+                |  ((binarray[i+2 >> 2] >> 8 * ((i+2)%4)) & 0xFF);
+    for(var j = 0; j < 4; j++)
+    {
+      if(i * 8 + j * 6 > binarray.length * 32) str += b64pad;
+      else str += tab.charAt((triplet >> 6*(3-j)) & 0x3F);
+    }
+  }
+  return str;
+}
+
+var plainText = "Rebellious subjects, enemies to peace,\n\
+Profaners of this neighbour-stained steel,--\n\
+Will they not hear? What, ho! you men, you beasts,\n\
+That quench the fire of your pernicious rage\n\
+With purple fountains issuing from your veins,\n\
+On pain of torture, from those bloody hands\n\
+Throw your mistemper'd weapons to the ground,\n\
+And hear the sentence of your moved prince.\n\
+Three civil brawls, bred of an airy word,\n\
+By thee, old Capulet, and Montague,\n\
+Have thrice disturb'd the quiet of our streets,\n\
+And made Verona's ancient citizens\n\
+Cast by their grave beseeming ornaments,\n\
+To wield old partisans, in hands as old,\n\
+Canker'd with peace, to part your canker'd hate:\n\
+If ever you disturb our streets again,\n\
+Your lives shall pay the forfeit of the peace.\n\
+For this time, all the rest depart away:\n\
+You Capulet; shall go along with me:\n\
+And, Montague, come you this afternoon,\n\
+To know our further pleasure in this case,\n\
+To old Free-town, our common judgment-place.\n\
+Once more, on pain of death, all men depart."
+
+for (var i = 0; i <9; i++) {
+    plainText += plainText;
+}
+
+for (var i = 0 ; i < 40; ++i) {
+    var md5Output = hex_md5(plainText);
+    
+    var expected = "3dfe3a86e990dc8bf5868823e917556e";
+    
+    if (md5Output != expected)
+        throw "ERROR: bad result: expected " + expected + " but got " + md5Output;
+}
+
+
diff --git a/PerformanceTests/LongSpider/crypto-sha1.js b/PerformanceTests/LongSpider/crypto-sha1.js
new file mode 100644
index 0000000..e1be516
--- /dev/null
+++ b/PerformanceTests/LongSpider/crypto-sha1.js
@@ -0,0 +1,231 @@
+/*
+ * A JavaScript implementation of the Secure Hash Algorithm, SHA-1, as defined
+ * in FIPS PUB 180-1
+ * Version 2.1a Copyright Paul Johnston 2000 - 2002.
+ * Other contributors: Greg Holt, Andrew Kepert, Ydnar, Lostinet
+ * Distributed under the BSD License
+ * See http://pajhome.org.uk/crypt/md5 for details.
+ */
+
+/*
+ * Configurable variables. You may need to tweak these to be compatible with
+ * the server-side, but the defaults work in most cases.
+ */
+var hexcase = 0;  /* hex output format. 0 - lowercase; 1 - uppercase        */
+var b64pad  = ""; /* base-64 pad character. "=" for strict RFC compliance   */
+var chrsz   = 8;  /* bits per input character. 8 - ASCII; 16 - Unicode      */
+
+/*
+ * These are the functions you'll usually want to call
+ * They take string arguments and return either hex or base-64 encoded strings
+ */
+function hex_sha1(s){return binb2hex(core_sha1(str2binb(s),s.length * chrsz));}
+function b64_sha1(s){return binb2b64(core_sha1(str2binb(s),s.length * chrsz));}
+function str_sha1(s){return binb2str(core_sha1(str2binb(s),s.length * chrsz));}
+function hex_hmac_sha1(key, data){ return binb2hex(core_hmac_sha1(key, data));}
+function b64_hmac_sha1(key, data){ return binb2b64(core_hmac_sha1(key, data));}
+function str_hmac_sha1(key, data){ return binb2str(core_hmac_sha1(key, data));}
+
+/*
+ * Perform a simple self-test to see if the VM is working
+ */
+function sha1_vm_test()
+{
+  return hex_sha1("abc") == "a9993e364706816aba3e25717850c26c9cd0d89d";
+}
+
+/*
+ * Calculate the SHA-1 of an array of big-endian words, and a bit length
+ */
+function core_sha1(x, len)
+{
+  /* append padding */
+  x[len >> 5] |= 0x80 << (24 - len % 32);
+  x[((len + 64 >> 9) << 4) + 15] = len;
+
+  var w = Array(80);
+  var a =  1732584193;
+  var b = -271733879;
+  var c = -1732584194;
+  var d =  271733878;
+  var e = -1009589776;
+
+  for(var i = 0; i < x.length; i += 16)
+  {
+    var olda = a;
+    var oldb = b;
+    var oldc = c;
+    var oldd = d;
+    var olde = e;
+
+    for(var j = 0; j < 80; j++)
+    {
+      if(j < 16) w[j] = x[i + j];
+      else w[j] = rol(w[j-3] ^ w[j-8] ^ w[j-14] ^ w[j-16], 1);
+      var t = safe_add(safe_add(rol(a, 5), sha1_ft(j, b, c, d)),
+                       safe_add(safe_add(e, w[j]), sha1_kt(j)));
+      e = d;
+      d = c;
+      c = rol(b, 30);
+      b = a;
+      a = t;
+    }
+
+    a = safe_add(a, olda);
+    b = safe_add(b, oldb);
+    c = safe_add(c, oldc);
+    d = safe_add(d, oldd);
+    e = safe_add(e, olde);
+  }
+  return Array(a, b, c, d, e);
+
+}
+
+/*
+ * Perform the appropriate triplet combination function for the current
+ * iteration
+ */
+function sha1_ft(t, b, c, d)
+{
+  if(t < 20) return (b & c) | ((~b) & d);
+  if(t < 40) return b ^ c ^ d;
+  if(t < 60) return (b & c) | (b & d) | (c & d);
+  return b ^ c ^ d;
+}
+
+/*
+ * Determine the appropriate additive constant for the current iteration
+ */
+function sha1_kt(t)
+{
+  return (t < 20) ?  1518500249 : (t < 40) ?  1859775393 :
+         (t < 60) ? -1894007588 : -899497514;
+}
+
+/*
+ * Calculate the HMAC-SHA1 of a key and some data
+ */
+function core_hmac_sha1(key, data)
+{
+  var bkey = str2binb(key);
+  if(bkey.length > 16) bkey = core_sha1(bkey, key.length * chrsz);
+
+  var ipad = Array(16), opad = Array(16);
+  for(var i = 0; i < 16; i++)
+  {
+    ipad[i] = bkey[i] ^ 0x36363636;
+    opad[i] = bkey[i] ^ 0x5C5C5C5C;
+  }
+
+  var hash = core_sha1(ipad.concat(str2binb(data)), 512 + data.length * chrsz);
+  return core_sha1(opad.concat(hash), 512 + 160);
+}
+
+/*
+ * Add integers, wrapping at 2^32. This uses 16-bit operations internally
+ * to work around bugs in some JS interpreters.
+ */
+function safe_add(x, y)
+{
+  var lsw = (x & 0xFFFF) + (y & 0xFFFF);
+  var msw = (x >> 16) + (y >> 16) + (lsw >> 16);
+  return (msw << 16) | (lsw & 0xFFFF);
+}
+
+/*
+ * Bitwise rotate a 32-bit number to the left.
+ */
+function rol(num, cnt)
+{
+  return (num << cnt) | (num >>> (32 - cnt));
+}
+
+/*
+ * Convert an 8-bit or 16-bit string to an array of big-endian words
+ * In 8-bit function, characters >255 have their hi-byte silently ignored.
+ */
+function str2binb(str)
+{
+  var bin = Array();
+  var mask = (1 << chrsz) - 1;
+  for(var i = 0; i < str.length * chrsz; i += chrsz)
+    bin[i>>5] |= (str.charCodeAt(i / chrsz) & mask) << (32 - chrsz - i%32);
+  return bin;
+}
+
+/*
+ * Convert an array of big-endian words to a string
+ */
+function binb2str(bin)
+{
+  var str = "";
+  var mask = (1 << chrsz) - 1;
+  for(var i = 0; i < bin.length * 32; i += chrsz)
+    str += String.fromCharCode((bin[i>>5] >>> (32 - chrsz - i%32)) & mask);
+  return str;
+}
+
+/*
+ * Convert an array of big-endian words to a hex string.
+ */
+function binb2hex(binarray)
+{
+  var hex_tab = hexcase ? "0123456789ABCDEF" : "0123456789abcdef";
+  var str = "";
+  for(var i = 0; i < binarray.length * 4; i++)
+  {
+    str += hex_tab.charAt((binarray[i>>2] >> ((3 - i%4)*8+4)) & 0xF) +
+           hex_tab.charAt((binarray[i>>2] >> ((3 - i%4)*8  )) & 0xF);
+  }
+  return str;
+}
+
+/*
+ * Convert an array of big-endian words to a base-64 string
+ */
+function binb2b64(binarray)
+{
+  var tab = "ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/";
+  var str = "";
+  for(var i = 0; i < binarray.length * 4; i += 3)
+  {
+    var triplet = (((binarray[i   >> 2] >> 8 * (3 -  i   %4)) & 0xFF) << 16)
+                | (((binarray[i+1 >> 2] >> 8 * (3 - (i+1)%4)) & 0xFF) << 8 )
+                |  ((binarray[i+2 >> 2] >> 8 * (3 - (i+2)%4)) & 0xFF);
+    for(var j = 0; j < 4; j++)
+    {
+      if(i * 8 + j * 6 > binarray.length * 32) str += b64pad;
+      else str += tab.charAt((triplet >> 6*(3-j)) & 0x3F);
+    }
+  }
+  return str;
+}
+
+
+var plainText = "Two households, both alike in dignity,\n\
+In fair Verona, where we lay our scene,\n\
+From ancient grudge break to new mutiny,\n\
+Where civil blood makes civil hands unclean.\n\
+From forth the fatal loins of these two foes\n\
+A pair of star-cross'd lovers take their life;\n\
+Whole misadventured piteous overthrows\n\
+Do with their death bury their parents' strife.\n\
+The fearful passage of their death-mark'd love,\n\
+And the continuance of their parents' rage,\n\
+Which, but their children's end, nought could remove,\n\
+Is now the two hours' traffic of our stage;\n\
+The which if you with patient ears attend,\n\
+What here shall miss, our toil shall strive to mend.";
+
+for (var i = 0; i <12; i++) {
+    plainText += plainText;
+}
+
+for (var i = 0; i < 10; ++i) {
+    var sha1Output = hex_sha1(plainText);
+    
+    var expected = "716b0011ef72c5b3f12733109d82ad5d66c788fc";
+    if (sha1Output != expected)
+        throw "ERROR: bad result: expected " + expected + " but got " + sha1Output;
+}
+
diff --git a/PerformanceTests/LongSpider/date-format-tofte.js b/PerformanceTests/LongSpider/date-format-tofte.js
new file mode 100644
index 0000000..e193ced
--- /dev/null
+++ b/PerformanceTests/LongSpider/date-format-tofte.js
@@ -0,0 +1,301 @@
+function arrayExists(array, x) {
+    for (var i = 0; i < array.length; i++) {
+        if (array[i] == x) return true;
+    }
+    return false;
+}
+
+Date.prototype.formatDate = function (input,time) {
+    // formatDate :
+    // a PHP date like function, for formatting date strings
+    // See: http://www.php.net/date
+    //
+    // input : format string
+    // time : epoch time (seconds, and optional)
+    //
+    // if time is not passed, formatting is based on 
+    // the current "this" date object's set time.
+    //
+    // supported:
+    // a, A, B, d, D, F, g, G, h, H, i, j, l (lowercase L), L, 
+    // m, M, n, O, r, s, S, t, U, w, W, y, Y, z
+    //
+    // unsupported:
+    // I (capital i), T, Z    
+
+    var switches =    ["a", "A", "B", "d", "D", "F", "g", "G", "h", "H", 
+                       "i", "j", "l", "L", "m", "M", "n", "O", "r", "s", 
+                       "S", "t", "U", "w", "W", "y", "Y", "z"];
+    var daysLong =    ["Sunday", "Monday", "Tuesday", "Wednesday", 
+                       "Thursday", "Friday", "Saturday"];
+    var daysShort =   ["Sun", "Mon", "Tue", "Wed", 
+                       "Thu", "Fri", "Sat"];
+    var monthsShort = ["Jan", "Feb", "Mar", "Apr",
+                       "May", "Jun", "Jul", "Aug", "Sep",
+                       "Oct", "Nov", "Dec"];
+    var monthsLong =  ["January", "February", "March", "April",
+                       "May", "June", "July", "August", "September",
+                       "October", "November", "December"];
+    var daysSuffix = ["st", "nd", "rd", "th", "th", "th", "th", // 1st - 7th
+                      "th", "th", "th", "th", "th", "th", "th", // 8th - 14th
+                      "th", "th", "th", "th", "th", "th", "st", // 15th - 21st
+                      "nd", "rd", "th", "th", "th", "th", "th", // 22nd - 28th
+                      "th", "th", "st"];                        // 29th - 31st
+
+    function a() {
+        // Lowercase Ante meridiem and Post meridiem
+        return self.getHours() > 11? "pm" : "am";
+    }
+    function A() {
+        // Uppercase Ante meridiem and Post meridiem
+        return self.getHours() > 11? "PM" : "AM";
+    }
+
+    function B(){
+        // Swatch internet time. code simply grabbed from ppk,
+        // since I was feeling lazy:
+        // http://www.xs4all.nl/~ppk/js/beat.html
+        var off = (self.getTimezoneOffset() + 60)*60;
+        var theSeconds = (self.getHours() * 3600) + 
+                         (self.getMinutes() * 60) + 
+                          self.getSeconds() + off;
+        var beat = Math.floor(theSeconds/86.4);
+        if (beat > 1000) beat -= 1000;
+        if (beat < 0) beat += 1000;
+        if ((""+beat).length == 1) beat = "00"+beat;
+        if ((""+beat).length == 2) beat = "0"+beat;
+        return beat;
+    }
+    
+    function d() {
+        // Day of the month, 2 digits with leading zeros
+        return new String(self.getDate()).length == 1?
+        "0"+self.getDate() : self.getDate();
+    }
+    function D() {
+        // A textual representation of a day, three letters
+        return daysShort[self.getDay()];
+    }
+    function F() {
+        // A full textual representation of a month
+        return monthsLong[self.getMonth()];
+    }
+    function g() {
+        // 12-hour format of an hour without leading zeros
+        return self.getHours() > 12? self.getHours()-12 : self.getHours();
+    }
+    function G() {
+        // 24-hour format of an hour without leading zeros
+        return self.getHours();
+    }
+    function h() {
+        // 12-hour format of an hour with leading zeros
+        if (self.getHours() > 12) {
+          var s = new String(self.getHours()-12);
+          return s.length == 1?
+          "0"+ (self.getHours()-12) : self.getHours()-12;
+        } else { 
+          var s = new String(self.getHours());
+          return s.length == 1?
+          "0"+self.getHours() : self.getHours();
+        }  
+    }
+    function H() {
+        // 24-hour format of an hour with leading zeros
+        return new String(self.getHours()).length == 1?
+        "0"+self.getHours() : self.getHours();
+    }
+    function i() {
+        // Minutes with leading zeros
+        return new String(self.getMinutes()).length == 1? 
+        "0"+self.getMinutes() : self.getMinutes(); 
+    }
+    function j() {
+        // Day of the month without leading zeros
+        return self.getDate();
+    }    
+    function l() {
+        // A full textual representation of the day of the week
+        return daysLong[self.getDay()];
+    }
+    function L() {
+        // leap year or not. 1 if leap year, 0 if not.
+        // the logic should match iso's 8601 standard.
+        var y_ = Y();
+        if (         
+            (y_ % 4 == 0 && y_ % 100 != 0) ||
+            (y_ % 4 == 0 && y_ % 100 == 0 && y_ % 400 == 0)
+            ) {
+            return 1;
+        } else {
+            return 0;
+        }
+    }
+    function m() {
+        // Numeric representation of a month, with leading zeros
+        return self.getMonth() < 9?
+        "0"+(self.getMonth()+1) : 
+        self.getMonth()+1;
+    }
+    function M() {
+        // A short textual representation of a month, three letters
+        return monthsShort[self.getMonth()];
+    }
+    function n() {
+        // Numeric representation of a month, without leading zeros
+        return self.getMonth()+1;
+    }
+    function O() {
+        // Difference to Greenwich time (GMT) in hours
+        var os = Math.abs(self.getTimezoneOffset());
+        var h = ""+Math.floor(os/60);
+        var m = ""+(os%60);
+        h.length == 1? h = "0"+h:1;
+        m.length == 1? m = "0"+m:1;
+        return self.getTimezoneOffset() < 0 ? "+"+h+m : "-"+h+m;
+    }
+    function r() {
+        // RFC 822 formatted date
+        var r; // result
+        //  Thu    ,     21          Dec         2000
+        r = D() + ", " + j() + " " + M() + " " + Y() +
+        //        16     :    01     :    07          +0200
+            " " + H() + ":" + i() + ":" + s() + " " + O();
+        return r;
+    }
+    function S() {
+        // English ordinal suffix for the day of the month, 2 characters
+        return daysSuffix[self.getDate()-1];
+    }
+    function s() {
+        // Seconds, with leading zeros
+        return new String(self.getSeconds()).length == 1?
+        "0"+self.getSeconds() : self.getSeconds();
+    }
+    function t() {
+
+        // thanks to Matt Bannon for some much needed code-fixes here!
+        var daysinmonths = [null,31,28,31,30,31,30,31,31,30,31,30,31];
+        if (L()==1 && n()==2) return 29; // leap day
+        return daysinmonths[n()];
+    }
+    function U() {
+        // Seconds since the Unix Epoch (January 1 1970 00:00:00 GMT)
+        return Math.round(self.getTime()/1000);
+    }
+    function W() {
+        // Weeknumber, as per ISO specification:
+        // http://www.cl.cam.ac.uk/~mgk25/iso-time.html
+        
+        // if the day is three days before newyears eve,
+        // there's a chance it's "week 1" of next year.
+        // here we check for that.
+        var beforeNY = 364+L() - z();
+        var afterNY  = z();
+        var weekday = w()!=0?w()-1:6; // makes sunday (0), into 6.
+        if (beforeNY <= 2 && weekday <= 2-beforeNY) {
+            return 1;
+        }
+        // similarly, if the day is within threedays of newyears
+        // there's a chance it belongs in the old year.
+        var ny = new Date("January 1 " + Y() + " 00:00:00");
+        var nyDay = ny.getDay()!=0?ny.getDay()-1:6;
+        if (
+            (afterNY <= 2) && 
+            (nyDay >=4)  && 
+            (afterNY >= (6-nyDay))
+            ) {
+            // Since I'm not sure we can just always return 53,
+            // i call the function here again, using the last day
+            // of the previous year, as the date, and then just
+            // return that week.
+            var prevNY = new Date("December 31 " + (Y()-1) + " 00:00:00");
+            return prevNY.formatDate("W");
+        }
+        
+        // week 1, is the week that has the first thursday in it.
+        // note that this value is not zero index.
+        if (nyDay <= 3) {
+            // first day of the year fell on a thursday, or earlier.
+            return 1 + Math.floor( ( z() + nyDay ) / 7 );
+        } else {
+            // first day of the year fell on a friday, or later.
+            return 1 + Math.floor( ( z() - ( 7 - nyDay ) ) / 7 );
+        }
+    }
+    function w() {
+        // Numeric representation of the day of the week
+        return self.getDay();
+    }
+    
+    function Y() {
+        // A full numeric representation of a year, 4 digits
+
+        // we first check, if getFullYear is supported. if it
+        // is, we just use that. ppks code is nice, but wont
+        // work with dates outside 1900-2038, or something like that
+        if (self.getFullYear) {
+            var newDate = new Date("January 1 2001 00:00:00 +0000");
+            var x = newDate .getFullYear();
+            if (x == 2001) {              
+                // i trust the method now
+                return self.getFullYear();
+            }
+        }
+        // else, do this:
+        // codes thanks to ppk:
+        // http://www.xs4all.nl/~ppk/js/introdate.html
+        var x = self.getYear();
+        var y = x % 100;
+        y += (y < 38) ? 2000 : 1900;
+        return y;
+    }
+    function y() {
+        // A two-digit representation of a year
+        var y = Y()+"";
+        return y.substring(y.length-2,y.length);
+    }
+    function z() {
+        // The day of the year, zero indexed! 0 through 366
+        var t = new Date("January 1 " + Y() + " 00:00:00");
+        var diff = self.getTime() - t.getTime();
+        return Math.floor(diff/1000/60/60/24);
+    }
+        
+    var self = this;
+    if (time) {
+        // save time
+        var prevTime = self.getTime();
+        self.setTime(time);
+    }
+    
+    var ia = input.split("");
+    var ij = 0;
+    while (ia[ij]) {
+        if (ia[ij] == "\\") {
+            // this is our way of allowing users to escape stuff
+            ia.splice(ij,1);
+        } else {
+            if (arrayExists(switches,ia[ij])) {
+                ia[ij] = eval(ia[ij] + "()");
+            }
+        }
+        ij++;
+    }
+    // reset time, back to what it was
+    if (prevTime) {
+        self.setTime(prevTime);
+    }
+    return ia.join("");
+}
+
+var date = new Date("1/1/2007 1:11:11");
+
+for (i = 0; i < 60000; ++i) {
+    var shortFormat = date.formatDate("Y-m-d");
+    var longFormat = date.formatDate("l, F d, Y g:i:s A");
+    date.setTime(date.getTime() + 84266956);
+}
+
+// FIXME: Find a way to validate this test.
+// https://bugs.webkit.org/show_bug.cgi?id=114849
diff --git a/PerformanceTests/LongSpider/date-format-xparb.js b/PerformanceTests/LongSpider/date-format-xparb.js
new file mode 100644
index 0000000..b5d70ee
--- /dev/null
+++ b/PerformanceTests/LongSpider/date-format-xparb.js
@@ -0,0 +1,420 @@
+/*
+ * Copyright (C) 2004 Baron Schwartz <baron at sequent dot org>
+ *
+ * This program is free software; you can redistribute it and/or modify it
+ * under the terms of the GNU Lesser General Public License as published by the
+ * Free Software Foundation, version 2.1.
+ *
+ * This program is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS
+ * FOR A PARTICULAR PURPOSE.  See the GNU Lesser General Public License for more
+ * details.
+ */
+
+Date.parseFunctions = {count:0};
+Date.parseRegexes = [];
+Date.formatFunctions = {count:0};
+
+Date.prototype.dateFormat = function(format) {
+    if (Date.formatFunctions[format] == null) {
+        Date.createNewFormat(format);
+    }
+    var func = Date.formatFunctions[format];
+    return this[func]();
+}
+
+Date.createNewFormat = function(format) {
+    var funcName = "format" + Date.formatFunctions.count++;
+    Date.formatFunctions[format] = funcName;
+    var code = "Date.prototype." + funcName + " = function(){return ";
+    var special = false;
+    var ch = '';
+    for (var i = 0; i < format.length; ++i) {
+        ch = format.charAt(i);
+        if (!special && ch == "\\") {
+            special = true;
+        }
+        else if (special) {
+            special = false;
+            code += "'" + String.escape(ch) + "' + ";
+        }
+        else {
+            code += Date.getFormatCode(ch);
+        }
+    }
+    eval(code.substring(0, code.length - 3) + ";}");
+}
+
+Date.getFormatCode = function(character) {
+    switch (character) {
+    case "d":
+        return "String.leftPad(this.getDate(), 2, '0') + ";
+    case "D":
+        return "Date.dayNames[this.getDay()].substring(0, 3) + ";
+    case "j":
+        return "this.getDate() + ";
+    case "l":
+        return "Date.dayNames[this.getDay()] + ";
+    case "S":
+        return "this.getSuffix() + ";
+    case "w":
+        return "this.getDay() + ";
+    case "z":
+        return "this.getDayOfYear() + ";
+    case "W":
+        return "this.getWeekOfYear() + ";
+    case "F":
+        return "Date.monthNames[this.getMonth()] + ";
+    case "m":
+        return "String.leftPad(this.getMonth() + 1, 2, '0') + ";
+    case "M":
+        return "Date.monthNames[this.getMonth()].substring(0, 3) + ";
+    case "n":
+        return "(this.getMonth() + 1) + ";
+    case "t":
+        return "this.getDaysInMonth() + ";
+    case "L":
+        return "(this.isLeapYear() ? 1 : 0) + ";
+    case "Y":
+        return "this.getFullYear() + ";
+    case "y":
+        return "('' + this.getFullYear()).substring(2, 4) + ";
+    case "a":
+        return "(this.getHours() < 12 ? 'am' : 'pm') + ";
+    case "A":
+        return "(this.getHours() < 12 ? 'AM' : 'PM') + ";
+    case "g":
+        return "((this.getHours() %12) ? this.getHours() % 12 : 12) + ";
+    case "G":
+        return "this.getHours() + ";
+    case "h":
+        return "String.leftPad((this.getHours() %12) ? this.getHours() % 12 : 12, 2, '0') + ";
+    case "H":
+        return "String.leftPad(this.getHours(), 2, '0') + ";
+    case "i":
+        return "String.leftPad(this.getMinutes(), 2, '0') + ";
+    case "s":
+        return "String.leftPad(this.getSeconds(), 2, '0') + ";
+    case "O":
+        return "this.getGMTOffset() + ";
+    case "T":
+        return "this.getTimezone() + ";
+    case "Z":
+        return "(this.getTimezoneOffset() * -60) + ";
+    default:
+        return "'" + String.escape(character) + "' + ";
+    }
+}
+
+Date.parseDate = function(input, format) {
+    if (Date.parseFunctions[format] == null) {
+        Date.createParser(format);
+    }
+    var func = Date.parseFunctions[format];
+    return Date[func](input);
+}
+
+Date.createParser = function(format) {
+    var funcName = "parse" + Date.parseFunctions.count++;
+    var regexNum = Date.parseRegexes.length;
+    var currentGroup = 1;
+    Date.parseFunctions[format] = funcName;
+
+    var code = "Date." + funcName + " = function(input){\n"
+        + "var y = -1, m = -1, d = -1, h = -1, i = -1, s = -1;\n"
+        + "var d = new Date();\n"
+        + "y = d.getFullYear();\n"
+        + "m = d.getMonth();\n"
+        + "d = d.getDate();\n"
+        + "var results = input.match(Date.parseRegexes[" + regexNum + "]);\n"
+        + "if (results && results.length > 0) {"
+    var regex = "";
+
+    var special = false;
+    var ch = '';
+    for (var i = 0; i < format.length; ++i) {
+        ch = format.charAt(i);
+        if (!special && ch == "\\") {
+            special = true;
+        }
+        else if (special) {
+            special = false;
+            regex += String.escape(ch);
+        }
+        else {
+            obj = Date.formatCodeToRegex(ch, currentGroup);
+            currentGroup += obj.g;
+            regex += obj.s;
+            if (obj.g && obj.c) {
+                code += obj.c;
+            }
+        }
+    }
+
+    code += "if (y > 0 && m >= 0 && d > 0 && h >= 0 && i >= 0 && s >= 0)\n"
+        + "{return new Date(y, m, d, h, i, s);}\n"
+        + "else if (y > 0 && m >= 0 && d > 0 && h >= 0 && i >= 0)\n"
+        + "{return new Date(y, m, d, h, i);}\n"
+        + "else if (y > 0 && m >= 0 && d > 0 && h >= 0)\n"
+        + "{return new Date(y, m, d, h);}\n"
+        + "else if (y > 0 && m >= 0 && d > 0)\n"
+        + "{return new Date(y, m, d);}\n"
+        + "else if (y > 0 && m >= 0)\n"
+        + "{return new Date(y, m);}\n"
+        + "else if (y > 0)\n"
+        + "{return new Date(y);}\n"
+        + "}return null;}";
+
+    Date.parseRegexes[regexNum] = new RegExp("^" + regex + "$");
+    eval(code);
+}
+
+Date.formatCodeToRegex = function(character, currentGroup) {
+    switch (character) {
+    case "D":
+        return {g:0,
+        c:null,
+        s:"(?:Sun|Mon|Tue|Wed|Thu|Fri|Sat)"};
+    case "j":
+    case "d":
+        return {g:1,
+            c:"d = parseInt(results[" + currentGroup + "], 10);\n",
+            s:"(\\d{1,2})"};
+    case "l":
+        return {g:0,
+            c:null,
+            s:"(?:" + Date.dayNames.join("|") + ")"};
+    case "S":
+        return {g:0,
+            c:null,
+            s:"(?:st|nd|rd|th)"};
+    case "w":
+        return {g:0,
+            c:null,
+            s:"\\d"};
+    case "z":
+        return {g:0,
+            c:null,
+            s:"(?:\\d{1,3})"};
+    case "W":
+        return {g:0,
+            c:null,
+            s:"(?:\\d{2})"};
+    case "F":
+        return {g:1,
+            c:"m = parseInt(Date.monthNumbers[results[" + currentGroup + "].substring(0, 3)], 10);\n",
+            s:"(" + Date.monthNames.join("|") + ")"};
+    case "M":
+        return {g:1,
+            c:"m = parseInt(Date.monthNumbers[results[" + currentGroup + "]], 10);\n",
+            s:"(Jan|Feb|Mar|Apr|May|Jun|Jul|Aug|Sep|Oct|Nov|Dec)"};
+    case "n":
+    case "m":
+        return {g:1,
+            c:"m = parseInt(results[" + currentGroup + "], 10) - 1;\n",
+            s:"(\\d{1,2})"};
+    case "t":
+        return {g:0,
+            c:null,
+            s:"\\d{1,2}"};
+    case "L":
+        return {g:0,
+            c:null,
+            s:"(?:1|0)"};
+    case "Y":
+        return {g:1,
+            c:"y = parseInt(results[" + currentGroup + "], 10);\n",
+            s:"(\\d{4})"};
+    case "y":
+        return {g:1,
+            c:"var ty = parseInt(results[" + currentGroup + "], 10);\n"
+                + "y = ty > Date.y2kYear ? 1900 + ty : 2000 + ty;\n",
+            s:"(\\d{1,2})"};
+    case "a":
+        return {g:1,
+            c:"if (results[" + currentGroup + "] == 'am') {\n"
+                + "if (h == 12) { h = 0; }\n"
+                + "} else { if (h < 12) { h += 12; }}",
+            s:"(am|pm)"};
+    case "A":
+        return {g:1,
+            c:"if (results[" + currentGroup + "] == 'AM') {\n"
+                + "if (h == 12) { h = 0; }\n"
+                + "} else { if (h < 12) { h += 12; }}",
+            s:"(AM|PM)"};
+    case "g":
+    case "G":
+    case "h":
+    case "H":
+        return {g:1,
+            c:"h = parseInt(results[" + currentGroup + "], 10);\n",
+            s:"(\\d{1,2})"};
+    case "i":
+        return {g:1,
+            c:"i = parseInt(results[" + currentGroup + "], 10);\n",
+            s:"(\\d{2})"};
+    case "s":
+        return {g:1,
+            c:"s = parseInt(results[" + currentGroup + "], 10);\n",
+            s:"(\\d{2})"};
+    case "O":
+        return {g:0,
+            c:null,
+            s:"[+-]\\d{4}"};
+    case "T":
+        return {g:0,
+            c:null,
+            s:"[A-Z]{3}"};
+    case "Z":
+        return {g:0,
+            c:null,
+            s:"[+-]\\d{1,5}"};
+    default:
+        return {g:0,
+            c:null,
+            s:String.escape(character)};
+    }
+}
+
+Date.prototype.getTimezone = function() {
+    return this.toString().replace(
+        /^.*? ([A-Z]{3}) [0-9]{4}.*$/, "$1").replace(
+        /^.*?\(([A-Z])[a-z]+ ([A-Z])[a-z]+ ([A-Z])[a-z]+\)$/, "$1$2$3");
+}
+
+Date.prototype.getGMTOffset = function() {
+    return (this.getTimezoneOffset() > 0 ? "-" : "+")
+        + String.leftPad(Math.floor(this.getTimezoneOffset() / 60), 2, "0")
+        + String.leftPad(this.getTimezoneOffset() % 60, 2, "0");
+}
+
+Date.prototype.getDayOfYear = function() {
+    var num = 0;
+    Date.daysInMonth[1] = this.isLeapYear() ? 29 : 28;
+    for (var i = 0; i < this.getMonth(); ++i) {
+        num += Date.daysInMonth[i];
+    }
+    return num + this.getDate() - 1;
+}
+
+Date.prototype.getWeekOfYear = function() {
+    // Skip to Thursday of this week
+    var now = this.getDayOfYear() + (4 - this.getDay());
+    // Find the first Thursday of the year
+    var jan1 = new Date(this.getFullYear(), 0, 1);
+    var then = (7 - jan1.getDay() + 4);
+    document.write(then);
+    return String.leftPad(((now - then) / 7) + 1, 2, "0");
+}
+
+Date.prototype.isLeapYear = function() {
+    var year = this.getFullYear();
+    return ((year & 3) == 0 && (year % 100 || (year % 400 == 0 && year)));
+}
+
+Date.prototype.getFirstDayOfMonth = function() {
+    var day = (this.getDay() - (this.getDate() - 1)) % 7;
+    return (day < 0) ? (day + 7) : day;
+}
+
+Date.prototype.getLastDayOfMonth = function() {
+    var day = (this.getDay() + (Date.daysInMonth[this.getMonth()] - this.getDate())) % 7;
+    return (day < 0) ? (day + 7) : day;
+}
+
+Date.prototype.getDaysInMonth = function() {
+    Date.daysInMonth[1] = this.isLeapYear() ? 29 : 28;
+    return Date.daysInMonth[this.getMonth()];
+}
+
+Date.prototype.getSuffix = function() {
+    switch (this.getDate()) {
+        case 1:
+        case 21:
+        case 31:
+            return "st";
+        case 2:
+        case 22:
+            return "nd";
+        case 3:
+        case 23:
+            return "rd";
+        default:
+            return "th";
+    }
+}
+
+String.escape = function(string) {
+    return string.replace(/('|\\)/g, "\\$1");
+}
+
+String.leftPad = function (val, size, ch) {
+    var result = new String(val);
+    if (ch == null) {
+        ch = " ";
+    }
+    while (result.length < size) {
+        result = ch + result;
+    }
+    return result;
+}
+
+Date.daysInMonth = [31,28,31,30,31,30,31,31,30,31,30,31];
+Date.monthNames =
+   ["January",
+    "February",
+    "March",
+    "April",
+    "May",
+    "June",
+    "July",
+    "August",
+    "September",
+    "October",
+    "November",
+    "December"];
+Date.dayNames =
+   ["Sunday",
+    "Monday",
+    "Tuesday",
+    "Wednesday",
+    "Thursday",
+    "Friday",
+    "Saturday"];
+Date.y2kYear = 50;
+Date.monthNumbers = {
+    Jan:0,
+    Feb:1,
+    Mar:2,
+    Apr:3,
+    May:4,
+    Jun:5,
+    Jul:6,
+    Aug:7,
+    Sep:8,
+    Oct:9,
+    Nov:10,
+    Dec:11};
+Date.patterns = {
+    ISO8601LongPattern:"Y-m-d H:i:s",
+    ISO8601ShortPattern:"Y-m-d",
+    ShortDatePattern: "n/j/Y",
+    LongDatePattern: "l, F d, Y",
+    FullDateTimePattern: "l, F d, Y g:i:s A",
+    MonthDayPattern: "F d",
+    ShortTimePattern: "g:i A",
+    LongTimePattern: "g:i:s A",
+    SortableDateTimePattern: "Y-m-d\\TH:i:s",
+    UniversalSortableDateTimePattern: "Y-m-d H:i:sO",
+    YearMonthPattern: "F, Y"};
+
+var date = new Date("1/1/2007 1:11:11");
+
+for (i = 0; i < 900000; ++i) {
+    var shortFormat = date.dateFormat("Y-m-d");
+    var longFormat = date.dateFormat("l, F d, Y g:i:s A");
+    date.setTime(date.getTime() + 84266956);
+}
+
+// FIXME: Find a way to validate this test.
+// https://bugs.webkit.org/show_bug.cgi?id=114849
diff --git a/PerformanceTests/LongSpider/math-cordic.js b/PerformanceTests/LongSpider/math-cordic.js
new file mode 100644
index 0000000..790480e
--- /dev/null
+++ b/PerformanceTests/LongSpider/math-cordic.js
@@ -0,0 +1,106 @@
+/*
+ * Copyright (C) Rich Moore.  All rights reserved.
+ *
+ * Redistribution and use in source and binary forms, with or without
+ * modification, are permitted provided that the following conditions
+ * are met:
+ * 1. Redistributions of source code must retain the above copyright
+ *    notice, this list of conditions and the following disclaimer.
+ * 2. Redistributions in binary form must reproduce the above copyright
+ *    notice, this list of conditions and the following disclaimer in the
+ *    documentation and/or other materials provided with the distribution.
+ *
+ * THIS SOFTWARE IS PROVIDED BY CONTRIBUTORS ``AS IS'' AND ANY
+ * EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+ * PURPOSE ARE DISCLAIMED.  IN NO EVENT SHALL APPLE COMPUTER, INC. OR
+ * CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+ * EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+ * PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR
+ * PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY
+ * OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT
+ * (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE
+ * OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. 
+ */
+
+/////. Start CORDIC
+
+var AG_CONST = 0.6072529350;
+
+function FIXED(X)
+{
+  return X * 65536.0;
+}
+
+function FLOAT(X)
+{
+  return X / 65536.0;
+}
+
+function DEG2RAD(X)
+{
+  return 0.017453 * (X);
+}
+
+var Angles = [
+  FIXED(45.0), FIXED(26.565), FIXED(14.0362), FIXED(7.12502),
+  FIXED(3.57633), FIXED(1.78991), FIXED(0.895174), FIXED(0.447614),
+  FIXED(0.223811), FIXED(0.111906), FIXED(0.055953),
+  FIXED(0.027977) 
+              ];
+
+var Target = 28.027;
+
+function cordicsincos(Target) {
+    var X;
+    var Y;
+    var TargetAngle;
+    var CurrAngle;
+    var Step;
+ 
+    X = FIXED(AG_CONST);         /* AG_CONST * cos(0) */
+    Y = 0;                       /* AG_CONST * sin(0) */
+
+    TargetAngle = FIXED(Target);
+    CurrAngle = 0;
+    for (Step = 0; Step < 12; Step++) {
+        var NewX;
+        if (TargetAngle > CurrAngle) {
+            NewX = X - (Y >> Step);
+            Y = (X >> Step) + Y;
+            X = NewX;
+            CurrAngle += Angles[Step];
+        } else {
+            NewX = X + (Y >> Step);
+            Y = -(X >> Step) + Y;
+            X = NewX;
+            CurrAngle -= Angles[Step];
+        }
+    }
+
+    return FLOAT(X) * FLOAT(Y);
+}
+
+///// End CORDIC
+
+var total = 0;
+
+function cordic( runs ) {
+  var start = new Date();
+
+  for ( var i = 0 ; i < runs ; i++ ) {
+      total += cordicsincos(Target);
+  }
+
+  var end = new Date();
+
+  return end.getTime() - start.getTime();
+}
+
+cordic(13000000);
+
+var expected = 5388536.644120298;
+
+if (total != expected)
+    throw "ERROR: bad result: expected " + expected + " but got " + total;
+
diff --git a/PerformanceTests/LongSpider/math-partial-sums.js b/PerformanceTests/LongSpider/math-partial-sums.js
new file mode 100644
index 0000000..4ece357
--- /dev/null
+++ b/PerformanceTests/LongSpider/math-partial-sums.js
@@ -0,0 +1,45 @@
+// The Computer Language Shootout
+// http://shootout.alioth.debian.org/
+// contributed by Isaac Gouy
+
+function partial(n){
+    var a1 = a2 = a3 = a4 = a5 = a6 = a7 = a8 = a9 = 0.0;
+    var twothirds = 2.0/3.0;
+    var alt = -1.0;
+    var k2 = k3 = sk = ck = 0.0;
+    
+    for (var k = 1; k <= n; k++){
+        k2 = k*k;
+        k3 = k2*k;
+        sk = Math.sin(k);
+        ck = Math.cos(k);
+        alt = -alt;
+        
+        a1 += Math.pow(twothirds,k-1);
+        a2 += Math.pow(k,-0.5);
+        a3 += 1.0/(k*(k+1.0));
+        a4 += 1.0/(k3 * sk*sk);
+        a5 += 1.0/(k3 * ck*ck);
+        a6 += 1.0/k;
+        a7 += 1.0/k2;
+        a8 += alt/k;
+        a9 += alt/(2*k -1);
+    }
+    
+    // NOTE: We don't try to validate anything from pow(),  sin() or cos() because those aren't
+    // well-specified in ECMAScript.
+    return a6 + a7 + a8 + a9;
+}
+
+var total = 0;
+
+for (var i = 1024; i <= 2097152; i *= 2) {
+    total += partial(i);
+}
+
+var expected = 173.3312765300306;
+
+if (total != expected) {
+    throw "ERROR: bad result: expected " + expected + " but got " + total;
+}
+
diff --git a/PerformanceTests/LongSpider/math-spectral-norm.js b/PerformanceTests/LongSpider/math-spectral-norm.js
new file mode 100644
index 0000000..b79cf01
--- /dev/null
+++ b/PerformanceTests/LongSpider/math-spectral-norm.js
@@ -0,0 +1,59 @@
+// The Great Computer Language Shootout
+// http://shootout.alioth.debian.org/
+//
+// contributed by Ian Osgood
+
+function A(i,j) {
+  return 1/((i+j)*(i+j+1)/2+i+1);
+}
+
+function Au(u,v) {
+  for (var i=0; i<u.length; ++i) {
+    var t = 0;
+    for (var j=0; j<u.length; ++j)
+      t += A(i,j) * u[j];
+    v[i] = t;
+  }
+}
+
+function Atu(u,v) {
+  for (var i=0; i<u.length; ++i) {
+    var t = 0;
+    for (var j=0; j<u.length; ++j)
+      t += A(j,i) * u[j];
+    v[i] = t;
+  }
+}
+
+function AtAu(u,v,w) {
+  Au(u,w);
+  Atu(w,v);
+}
+
+function spectralnorm(n) {
+  var i, u=[], v=[], w=[], vv=0, vBv=0;
+  for (i=0; i<n; ++i) {
+    u[i] = 1; v[i] = w[i] = 0;
+  }
+  for (i=0; i<10; ++i) {
+    AtAu(u,v,w);
+    AtAu(v,u,w);
+  }
+  for (i=0; i<n; ++i) {
+    vBv += u[i]*v[i];
+    vv  += v[i]*v[i];
+  }
+  return Math.sqrt(vBv/vv);
+}
+
+var total = 0;
+
+for (var i = 6; i <= 2048; i *= 2) {
+    total += spectralnorm(i);
+}
+
+var expected = 11.4578095984282985;
+
+if (total != expected)
+    throw "ERROR: bad result: expected " + expected + " but got " + total;
+
diff --git a/PerformanceTests/LongSpider/string-base64.js b/PerformanceTests/LongSpider/string-base64.js
new file mode 100644
index 0000000..e9ed11e
--- /dev/null
+++ b/PerformanceTests/LongSpider/string-base64.js
@@ -0,0 +1,137 @@
+/* ***** BEGIN LICENSE BLOCK *****
+ * Version: MPL 1.1/GPL 2.0/LGPL 2.1
+ *
+ * The contents of this file are subject to the Mozilla Public License Version
+ * 1.1 (the "License"); you may not use this file except in compliance with
+ * the License. You may obtain a copy of the License at
+ * http://www.mozilla.org/MPL/
+ *
+ * Software distributed under the License is distributed on an "AS IS" basis,
+ * WITHOUT WARRANTY OF ANY KIND, either express or implied. See the License
+ * for the specific language governing rights and limitations under the
+ * License.
+ *
+ * The Original Code is Mozilla XML-RPC Client component.
+ *
+ * The Initial Developer of the Original Code is
+ * Digital Creations 2, Inc.
+ * Portions created by the Initial Developer are Copyright (C) 2000
+ * the Initial Developer. All Rights Reserved.
+ *
+ * Contributor(s):
+ *   Martijn Pieters <mj@digicool.com> (original author)
+ *   Samuel Sieb <samuel@sieb.net>
+ *
+ * Alternatively, the contents of this file may be used under the terms of
+ * either the GNU General Public License Version 2 or later (the "GPL"), or
+ * the GNU Lesser General Public License Version 2.1 or later (the "LGPL"),
+ * in which case the provisions of the GPL or the LGPL are applicable instead
+ * of those above. If you wish to allow use of your version of this file only
+ * under the terms of either the GPL or the LGPL, and not to allow others to
+ * use your version of this file under the terms of the MPL, indicate your
+ * decision by deleting the provisions above and replace them with the notice
+ * and other provisions required by the GPL or the LGPL. If you do not delete
+ * the provisions above, a recipient may use your version of this file under
+ * the terms of any one of the MPL, the GPL or the LGPL.
+ *
+ * ***** END LICENSE BLOCK ***** */
+
+// From: http://lxr.mozilla.org/mozilla/source/extensions/xml-rpc/src/nsXmlRpcClient.js#956
+
+/* Convert data (an array of integers) to a Base64 string. */
+var toBase64Table = 'ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/';
+var base64Pad = '=';
+
+function toBase64(data) {
+    var result = '';
+    var length = data.length;
+    var i;
+    // Convert every three bytes to 4 ascii characters.
+    for (i = 0; i < (length - 2); i += 3) {
+        result += toBase64Table[data.charCodeAt(i) >> 2];
+        result += toBase64Table[((data.charCodeAt(i) & 0x03) << 4) + (data.charCodeAt(i+1) >> 4)];
+        result += toBase64Table[((data.charCodeAt(i+1) & 0x0f) << 2) + (data.charCodeAt(i+2) >> 6)];
+        result += toBase64Table[data.charCodeAt(i+2) & 0x3f];
+    }
+
+    // Convert the remaining 1 or 2 bytes, pad out to 4 characters.
+    if (length%3) {
+        i = length - (length%3);
+        result += toBase64Table[data.charCodeAt(i) >> 2];
+        if ((length%3) == 2) {
+            result += toBase64Table[((data.charCodeAt(i) & 0x03) << 4) + (data.charCodeAt(i+1) >> 4)];
+            result += toBase64Table[(data.charCodeAt(i+1) & 0x0f) << 2];
+            result += base64Pad;
+        } else {
+            result += toBase64Table[(data.charCodeAt(i) & 0x03) << 4];
+            result += base64Pad + base64Pad;
+        }
+    }
+
+    return result;
+}
+
+/* Convert Base64 data to a string */
+var toBinaryTable = [
+    -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1,
+    -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,-1,
+    -1,-1,-1,-1, -1,-1,-1,-1, -1,-1,-1,62, -1,-1,-1,63,
+    52,53,54,55, 56,57,58,59, 60,61,-1,-1, -1, 0,-1,-1,
+    -1, 0, 1, 2,  3, 4, 5, 6,  7, 8, 9,10, 11,12,13,14,
+    15,16,17,18, 19,20,21,22, 23,24,25,-1, -1,-1,-1,-1,
+    -1,26,27,28, 29,30,31,32, 33,34,35,36, 37,38,39,40,
+    41,42,43,44, 45,46,47,48, 49,50,51,-1, -1,-1,-1,-1
+];
+
+function base64ToString(data) {
+    var result = '';
+    var leftbits = 0; // number of bits decoded, but yet to be appended
+    var leftdata = 0; // bits decoded, but yet to be appended
+
+    // Convert one by one.
+    for (var i = 0; i < data.length; i++) {
+        var c = toBinaryTable[data.charCodeAt(i) & 0x7f];
+        var padding = (data.charCodeAt(i) == base64Pad.charCodeAt(0));
+        // Skip illegal characters and whitespace
+        if (c == -1) continue;
+        
+        // Collect data into leftdata, update bitcount
+        leftdata = (leftdata << 6) | c;
+        leftbits += 6;
+
+        // If we have 8 or more bits, append 8 bits to the result
+        if (leftbits >= 8) {
+            leftbits -= 8;
+            // Append if not padding.
+            if (!padding)
+                result += String.fromCharCode((leftdata >> leftbits) & 0xff);
+            leftdata &= (1 << leftbits) - 1;
+        }
+    }
+
+    // If there are any bits left, the base64 string was corrupted
+    if (leftbits)
+        throw Components.Exception('Corrupted base64 string');
+
+    return result;
+}
+
+var str = "";
+
+for ( var i = 0; i < 8192; i++ )
+        str += String.fromCharCode( (25 * Math.random()) + 97 );
+
+for ( var i = 8192; i <= 2097152; i *= 2 ) {
+
+    var base64;
+
+    base64 = toBase64(str);
+    var encoded = base64ToString(base64);
+    if (encoded != str)
+        throw "ERROR: bad result: expected " + str + " but got " + encoded;
+
+    // Double the string
+    str += str;
+}
+
+toBinaryTable = null;
diff --git a/PerformanceTests/LongSpider/string-fasta.js b/PerformanceTests/LongSpider/string-fasta.js
new file mode 100644
index 0000000..d217126
--- /dev/null
+++ b/PerformanceTests/LongSpider/string-fasta.js
@@ -0,0 +1,90 @@
+// The Great Computer Language Shootout
+//  http://shootout.alioth.debian.org
+//
+//  Contributed by Ian Osgood
+
+var last = 42, A = 3877, C = 29573, M = 139968;
+
+function rand(max) {
+  last = (last * A + C) % M;
+  return max * last / M;
+}
+
+var ALU =
+  "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
+  "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
+  "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
+  "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
+  "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
+  "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
+  "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
+
+var IUB = {
+  a:0.27, c:0.12, g:0.12, t:0.27,
+  B:0.02, D:0.02, H:0.02, K:0.02,
+  M:0.02, N:0.02, R:0.02, S:0.02,
+  V:0.02, W:0.02, Y:0.02
+}
+
+var HomoSap = {
+  a: 0.3029549426680,
+  c: 0.1979883004921,
+  g: 0.1975473066391,
+  t: 0.3015094502008
+}
+
+function makeCumulative(table) {
+  var last = null;
+  for (var c in table) {
+    if (last) table[c] += table[last];
+    last = c;
+  }
+}
+
+function fastaRepeat(n, seq) {
+  var seqi = 0, lenOut = 60;
+  while (n>0) {
+    if (n<lenOut) lenOut = n;
+    if (seqi + lenOut < seq.length) {
+      ret += seq.substring(seqi, seqi+lenOut).length;
+      seqi += lenOut;
+    } else {
+      var s = seq.substring(seqi);
+      seqi = lenOut - s.length;
+      ret += (s + seq.substring(0, seqi)).length;
+    }
+    n -= lenOut;
+  }
+}
+
+function fastaRandom(n, table) {
+  var line = new Array(60);
+  makeCumulative(table);
+  while (n>0) {
+    if (n<line.length) line = new Array(n);
+    for (var i=0; i<line.length; i++) {
+      var r = rand(1);
+      for (var c in table) {
+        if (r < table[c]) {
+          line[i] = c;
+          break;
+        }
+      }
+    }
+    ret += line.join('').length;
+    n -= line.length;
+  }
+}
+
+var ret = 0;
+
+var count = 700;
+fastaRepeat(2*count*100000, ALU);
+fastaRandom(3*count*1000, IUB);
+fastaRandom(5*count*1000, HomoSap);
+
+var expected = 145600000;
+
+if (ret != expected)
+    throw "ERROR: bad result: expected " + expected + " but got " + ret;
+
diff --git a/PerformanceTests/LongSpider/string-tagcloud.js b/PerformanceTests/LongSpider/string-tagcloud.js
new file mode 100644
index 0000000..7a53411
--- /dev/null
+++ b/PerformanceTests/LongSpider/string-tagcloud.js
@@ -0,0 +1,274 @@
+
+/*
+ * Copyright (C) 2007 Apple Inc.  All rights reserved.
+ *
+ * Redistribution and use in source and binary forms, with or without
+ * modification, are permitted provided that the following conditions
+ * are met:
+ * 1. Redistributions of source code must retain the above copyright
+ *    notice, this list of conditions and the following disclaimer.
+ * 2. Redistributions in binary form must reproduce the above copyright
+ *    notice, this list of conditions and the following disclaimer in the
+ *    documentation and/or other materials provided with the distribution.
+ *
+ * THIS SOFTWARE IS PROVIDED BY APPLE COMPUTER, INC. ``AS IS'' AND ANY
+ * EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+ * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+ * PURPOSE ARE DISCLAIMED.  IN NO EVENT SHALL APPLE COMPUTER, INC. OR
+ * CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+ * EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+ * PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR
+ * PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY
+ * OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT
+ * (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE
+ * OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. 
+ */
+
+/*
+    Portions from:
+    json.js
+    2007-10-10
+
+    Public Domain
+*/
+
+// This test parses a JSON string giving tag names and popularity, and
+// generates html markup for a "tagcloud" view.
+
+if (!Object.prototype.toJSONString) {
+
+    Array.prototype.toJSONString = function (w) {
+        var a = [],     // The array holding the partial texts.
+            i,          // Loop counter.
+            l = this.length,
+            v;          // The value to be stringified.
+
+        for (i = 0; i < l; i += 1) {
+            v = this[i];
+            switch (typeof v) {
+            case 'object':
+
+                if (v && typeof v.toJSONString === 'function') {
+                    a.push(v.toJSONString(w));
+                } else {
+                    a.push('null');
+                }
+                break;
+
+            case 'string':
+            case 'number':
+            case 'boolean':
+                a.push(v.toJSONString());
+                break;
+            default:
+                a.push('null');
+            }
+        }
+
+        return '[' + a.join(',') + ']';
+    };
+
+
+    Boolean.prototype.toJSONString = function () {
+        return String(this);
+    };
+
+
+    Date.prototype.toJSONString = function () {
+
+        function f(n) {
+
+            return n < 10 ? '0' + n : n;
+        }
+
+        return '"' + this.getUTCFullYear()   + '-' +
+                   f(this.getUTCMonth() + 1) + '-' +
+                   f(this.getUTCDate())      + 'T' +
+                   f(this.getUTCHours())     + ':' +
+                   f(this.getUTCMinutes())   + ':' +
+                   f(this.getUTCSeconds())   + 'Z"';
+    };
+
+
+    Number.prototype.toJSONString = function () {
+
+        return isFinite(this) ? String(this) : 'null';
+    };
+
+
+    Object.prototype.toJSONString = function (w) {
+        var a = [],     // The array holding the partial texts.
+            k,          // The current key.
+            i,          // The loop counter.
+            v;          // The current value.
+
+        if (w) {
+            for (i = 0; i < w.length; i += 1) {
+                k = w[i];
+                if (typeof k === 'string') {
+                    v = this[k];
+                    switch (typeof v) {
+                    case 'object':
+
+                        if (v) {
+                            if (typeof v.toJSONString === 'function') {
+                                a.push(k.toJSONString() + ':' +
+                                       v.toJSONString(w));
+                            }
+                        } else {
+                            a.push(k.toJSONString() + ':null');
+                        }
+                        break;
+
+                    case 'string':
+                    case 'number':
+                    case 'boolean':
+                        a.push(k.toJSONString() + ':' + v.toJSONString());
+
+                    }
+                }
+            }
+        } else {
+
+            for (k in this) {
+                if (typeof k === 'string' &&
+                        Object.prototype.hasOwnProperty.apply(this, [k])) {
+                    v = this[k];
+                    switch (typeof v) {
+                    case 'object':
+
+                        if (v) {
+                            if (typeof v.toJSONString === 'function') {
+                                a.push(k.toJSONString() + ':' +
+                                       v.toJSONString());
+                            }
+                        } else {
+                            a.push(k.toJSONString() + ':null');
+                        }
+                        break;
+
+                    case 'string':
+                    case 'number':
+                    case 'boolean':
+                        a.push(k.toJSONString() + ':' + v.toJSONString());
+
+                    }
+                }
+            }
+        }
+
+        return '{' + a.join(',') + '}';
+    };
+
+
+    (function (s) {
+
+        var m = {
+            '\b': '\\b',
+            '\t': '\\t',
+            '\n': '\\n',
+            '\f': '\\f',
+            '\r': '\\r',
+            '"' : '\\"',
+            '\\': '\\\\'
+        };
+
+
+        s.parseJSON = function (filter) {
+            var j;
+
+            function walk(k, v) {
+                var i, n;
+                if (v && typeof v === 'object') {
+                    for (i in v) {
+                        if (Object.prototype.hasOwnProperty.apply(v, [i])) {
+                            n = walk(i, v[i]);
+                            if (n !== undefined) {
+                                v[i] = n;
+                            }
+                        }
+                    }
+                }
+                return filter(k, v);
+            }
+
+            if (/^[\],:{}\s]*$/.test(this.replace(/\\./g, '@').
+                    replace(/"[^"\\\n\r]*"|true|false|null|-?\d+(?:\.\d*)?(:?[eE][+\-]?\d+)?/g, ']').
+                    replace(/(?:^|:|,)(?:\s*\[)+/g, ''))) {
+
+                j = eval('(' + this + ')');
+
+                return typeof filter === 'function' ? walk('', j) : j;
+            }
+
+            throw new SyntaxError('parseJSON');
+        };
+
+
+        s.toJSONString = function () {
+
+            if (/["\\\x00-\x1f]/.test(this)) {
+                return '"' + this.replace(/[\x00-\x1f\\"]/g, function (a) {
+                    var c = m[a];
+                    if (c) {
+                        return c;
+                    }
+                    c = a.charCodeAt();
+                    return '\\u00' + Math.floor(c / 16).toString(16) +
+                                               (c % 16).toString(16);
+                }) + '"';
+            }
+            return '"' + this + '"';
+        };
+    })(String.prototype);
+}
+
+var tagInfoJSON = '[\n  {\n    \"tag\": "titillation",\n    \"popularity\": 4294967296\n  },\n  {\n    \"tag\": "foamless",\n    \"popularity\": 1257718401\n  },\n  {\n    \"tag\": "snarler",\n    \"popularity\": 613166183\n  },\n  {\n    \"tag\": "multangularness",\n    \"popularity\": 368304452\n  },\n  {\n    \"tag\": "Fesapo unventurous",\n    \"popularity\": 248026512\n  },\n  {\n    \"tag\": "esthesioblast",\n    \"popularity\": 179556755\n  },\n  {\n    \"tag\": "echeneidoid",\n    \"popularity\": 136641578\n  },\n  {\n    \"tag\": "embryoctony",\n    \"popularity\": 107852576\n  },\n  {\n    \"tag\": "undilatory",\n    \"popularity\": 87537981\n  },\n  {\n    \"tag\": "predisregard",\n    \"popularity\": 72630939\n  },\n  {\n    \"tag\": "allergenic",\n    \"popularity\": 61345190\n  },\n  {\n    \"tag\": "uncloudy",\n    \"popularity\": 52580571\n  },\n  {\n    \"tag\": "unforeseeably",\n    \"popularity\": 45628109\n  },\n  {\n    \"tag\": "sturniform",\n    \"popularity\": 40013489\n  },\n  {\n    \"tag\": "anesthetize",\n    \"popularity\": 35409226\n  },\n  {\n    \"tag\": "ametabolia",\n    \"popularity\": 31583050\n  },\n  {\n    \"tag\": "angiopathy",\n    \"popularity\": 28366350\n  },\n  {\n    \"tag\": "sultanaship",\n    \"popularity\": 25634218\n  },\n  {\n    \"tag\": "Frenchwise",\n    \"popularity\": 23292461\n  },\n  {\n    \"tag\": "cerviconasal",\n    \"popularity\": 21268909\n  },\n  {\n    \"tag\": "mercurialness",\n    \"popularity\": 19507481\n  },\n  {\n    \"tag\": "glutelin venditate",\n    \"popularity\": 17964042\n  },\n  {\n    \"tag\": "acred overblack",\n    \"popularity\": 16603454\n  },\n  {\n    \"tag\": "Atik",\n    \"popularity\": 15397451\n  },\n  {\n    \"tag\": "puncturer",\n    \"popularity\": 14323077\n  },\n  {\n    \"tag\": "pukatea",\n    \"popularity\": 13361525\n  },\n  {\n    \"tag\": "suberize",\n    \"popularity\": 12497261\n  },\n  {\n    \"tag\": "Godfrey",\n    \"popularity\": 11717365\n  },\n  {\n    \"tag\": "tetraptote",\n    \"popularity\": 11011011\n  },\n  {\n    \"tag\": "lucidness",\n    \"popularity\": 10369074\n  },\n  {\n    \"tag\": "tartness",\n    \"popularity\": 9783815\n  },\n  {\n    \"tag\": "axfetch",\n    \"popularity\": 9248634\n  },\n  {\n    \"tag\": "preacquittal",\n    \"popularity\": 8757877\n  },\n  {\n    \"tag\": "matris",\n    \"popularity\": 8306671\n  },\n  {\n    \"tag\": "hyphenate",\n    \"popularity\": 7890801\n  },\n  {\n    \"tag\": "semifabulous",\n    \"popularity\": 7506606\n  },\n  {\n    \"tag\": "oppressiveness",\n    \"popularity\": 7150890\n  },\n  {\n    \"tag\": "Protococcales",\n    \"popularity\": 6820856\n  },\n  {\n    \"tag\": "unpreventive",\n    \"popularity\": 6514045\n  },\n  {\n    \"tag\": "Cordia",\n    \"popularity\": 6228289\n  },\n  {\n    \"tag\": "Wakamba leaflike",\n    \"popularity\": 5961668\n  },\n  {\n    \"tag\": "dacryoma",\n    \"popularity\": 5712480\n  },\n  {\n    \"tag\": "inguinal",\n    \"popularity\": 5479211\n  },\n  {\n    \"tag\": "responseless",\n    \"popularity\": 5260507\n  },\n  {\n    \"tag\": "supplementarily",\n    \"popularity\": 5055158\n  },\n  {\n    \"tag\": "emu",\n    \"popularity\": 4862079\n  },\n  {\n    \"tag\": "countermeet",\n    \"popularity\": 4680292\n  },\n  {\n    \"tag\": "purrer",\n    \"popularity\": 4508918\n  },\n  {\n    \"tag\": "Corallinaceae",\n    \"popularity\": 4347162\n  },\n  {\n    \"tag\": "speculum",\n    \"popularity\": 4194304\n  },\n  {\n    \"tag\": "crimpness",\n    \"popularity\": 4049690\n  },\n  {\n    \"tag\": "antidetonant",\n    \"popularity\": 3912727\n  },\n  {\n    \"tag\": "topeewallah",\n    \"popularity\": 3782875\n  },\n  {\n    \"tag\": "fidalgo ballant",\n    \"popularity\": 3659640\n  },\n  {\n    \"tag\": "utriculose",\n    \"popularity\": 3542572\n  },\n  {\n    \"tag\": "testata",\n    \"popularity\": 3431259\n  },\n  {\n    \"tag\": "beltmaking",\n    \"popularity\": 3325322\n  },\n  {\n    \"tag\": "necrotype",\n    \"popularity\": 3224413\n  },\n  {\n    \"tag\": "ovistic",\n    \"popularity\": 3128215\n  },\n  {\n    \"tag\": "swindlership",\n    \"popularity\": 3036431\n  },\n  {\n    \"tag\": "augustal",\n    \"popularity\": 2948792\n  },\n  {\n    \"tag\": "Titoist",\n    \"popularity\": 2865047\n  },\n  {\n    \"tag\": "trisoctahedral",\n    \"popularity\": 2784963\n  },\n  {\n    \"tag\": "sequestrator",\n    \"popularity\": 2708327\n  },\n  {\n    \"tag\": "sideburns",\n    \"popularity\": 2634939\n  },\n  {\n    \"tag\": "paraphrasia",\n    \"popularity\": 2564616\n  },\n  {\n    \"tag\": "graminology unbay",\n    \"popularity\": 2497185\n  },\n  {\n    \"tag\": "acaridomatium emargination",\n    \"popularity\": 2432487\n  },\n  {\n    \"tag\": "roofward",\n    \"popularity\": 2370373\n  },\n  {\n    \"tag\": "lauder",\n    \"popularity\": 2310705\n  },\n  {\n    \"tag\": "subjunctive",\n    \"popularity\": 2253354\n  },\n  {\n    \"tag\": "subelongate",\n    \"popularity\": 2198199\n  },\n  {\n    \"tag\": "guacimo",\n    \"popularity\": 2145128\n  },\n  {\n    \"tag\": "cockade",\n    \"popularity\": 2094033\n  },\n  {\n    \"tag\": "misgauge",\n    \"popularity\": 2044818\n  },\n  {\n    \"tag\": "unexpensive",\n    \"popularity\": 1997388\n  },\n  {\n    \"tag\": "chebel",\n    \"popularity\": 1951657\n  },\n  {\n    \"tag\": "unpursuing",\n    \"popularity\": 1907543\n  },\n  {\n    \"tag\": "kilobar",\n    \"popularity\": 1864969\n  },\n  {\n    \"tag\": "obsecration",\n    \"popularity\": 1823863\n  },\n  {\n    \"tag\": "nacarine",\n    \"popularity\": 1784157\n  },\n  {\n    \"tag\": "spirituosity",\n    \"popularity\": 1745787\n  },\n  {\n    \"tag\": "movableness deity",\n    \"popularity\": 1708692\n  },\n  {\n    \"tag\": "exostracism",\n    \"popularity\": 1672816\n  },\n  {\n    \"tag\": "archipterygium",\n    \"popularity\": 1638104\n  },\n  {\n    \"tag\": "monostrophic",\n    \"popularity\": 1604506\n  },\n  {\n    \"tag\": "gynecide",\n    \"popularity\": 1571974\n  },\n  {\n    \"tag\": "gladden",\n    \"popularity\": 1540462\n  },\n  {\n    \"tag\": "throughbred",\n    \"popularity\": 1509927\n  },\n  {\n    \"tag\": "groper",\n    \"popularity\": 1480329\n  },\n  {\n    \"tag\": "Xenosaurus",\n    \"popularity\": 1451628\n  },\n  {\n    \"tag\": "photoetcher",\n    \"popularity\": 1423788\n  },\n  {\n    \"tag\": "glucosid",\n    \"popularity\": 1396775\n  },\n  {\n    \"tag\": "Galtonian",\n    \"popularity\": 1370555\n  },\n  {\n    \"tag\": "mesosporic",\n    \"popularity\": 1345097\n  },\n  {\n    \"tag\": "theody",\n    \"popularity\": 1320370\n  },\n  {\n    \"tag\": "zaffer",\n    \"popularity\": 1296348\n  },\n  {\n    \"tag\": "probiology",\n    \"popularity\": 1273003\n  },\n  {\n    \"tag\": "rhizomic",\n    \"popularity\": 1250308\n  },\n  {\n    \"tag\": "superphosphate",\n    \"popularity\": 1228240\n  },\n  {\n    \"tag\": "Hippolytan",\n    \"popularity\": 1206776\n  },\n  {\n    \"tag\": "garget",\n    \"popularity\": 1185892\n  },\n  {\n    \"tag\": "diploplacula",\n    \"popularity\": 1165568\n  },\n  {\n    \"tag\": "orohydrographical",\n    \"popularity\": 1145785\n  },\n  {\n    \"tag\": "enhypostatize",\n    \"popularity\": 1126521\n  },\n  {\n    \"tag\": "polisman",\n    \"popularity\": 1107759\n  },\n  {\n    \"tag\": "acetometer",\n    \"popularity\": 1089482\n  },\n  {\n    \"tag\": "unsnatched",\n    \"popularity\": 1071672\n  },\n  {\n    \"tag\": "yabber",\n    \"popularity\": 1054313\n  },\n  {\n    \"tag\": "demiwolf",\n    \"popularity\": 1037390\n  },\n  {\n    \"tag\": "chromascope",\n    \"popularity\": 1020888\n  },\n  {\n    \"tag\": "seamanship",\n    \"popularity\": 1004794\n  },\n  {\n    \"tag\": "nonfenestrated",\n    \"popularity\": 989092\n  },\n  {\n    \"tag\": "hydrophytism",\n    \"popularity\": 973771\n  },\n  {\n    \"tag\": "dotter",\n    \"popularity\": 958819\n  },\n  {\n    \"tag\": "thermoperiodism",\n    \"popularity\": 944222\n  },\n  {\n    \"tag\": "unlawyerlike",\n    \"popularity\": 929970\n  },\n  {\n    \"tag\": "enantiomeride citywards",\n    \"popularity\": 916052\n  },\n  {\n    \"tag\": "unmetallurgical",\n    \"popularity\": 902456\n  },\n  {\n    \"tag\": "prickled",\n    \"popularity\": 889174\n  },\n  {\n    \"tag\": "strangerwise manioc",\n    \"popularity\": 876195\n  },\n  {\n    \"tag\": "incisorial",\n    \"popularity\": 863510\n  },\n  {\n    \"tag\": "irrationalize",\n    \"popularity\": 851110\n  },\n  {\n    \"tag\": "nasology",\n    \"popularity\": 838987\n  },\n  {\n    \"tag\": "fatuism",\n    \"popularity\": 827131\n  },\n  {\n    \"tag\": "Huk",\n    \"popularity\": 815535\n  },\n  {\n    \"tag\": "properispomenon",\n    \"popularity\": 804192\n  },\n  {\n    \"tag\": "unpummelled",\n    \"popularity\": 793094\n  },\n  {\n    \"tag\": "technographically",\n    \"popularity\": 782233\n  },\n  {\n    \"tag\": "underfurnish",\n    \"popularity\": 771603\n  },\n  {\n    \"tag\": "sinter",\n    \"popularity\": 761198\n  },\n  {\n    \"tag\": "lateroanterior",\n    \"popularity\": 751010\n  },\n  {\n    \"tag\": "nonpersonification",\n    \"popularity\": 741034\n  },\n  {\n    \"tag\": "Sitophilus",\n    \"popularity\": 731264\n  },\n  {\n    \"tag\": "unstudded overexerted",\n    \"popularity\": 721694\n  },\n  {\n    \"tag\": "tracheation",\n    \"popularity\": 712318\n  },\n  {\n    \"tag\": "thirteenth begloze",\n    \"popularity\": 703131\n  },\n  {\n    \"tag\": "bespice",\n    \"popularity\": 694129\n  },\n  {\n    \"tag\": "doppia",\n    \"popularity\": 685305\n  },\n  {\n    \"tag\": "unadorned",\n    \"popularity\": 676656\n  },\n  {\n    \"tag\": "dovelet engraff",\n    \"popularity\": 668176\n  },\n  {\n    \"tag\": "diphyozooid",\n    \"popularity\": 659862\n  },\n  {\n    \"tag\": "mure",\n    \"popularity\": 651708\n  },\n  {\n    \"tag\": "Tripitaka",\n    \"popularity\": 643710\n  },\n  {\n    \"tag\": "Billjim",\n    \"popularity\": 635865\n  },\n  {\n    \"tag\": "pyramidical",\n    \"popularity\": 628169\n  },\n  {\n    \"tag\": "circumlocutionist",\n    \"popularity\": 620617\n  },\n  {\n    \"tag\": "slapstick",\n    \"popularity\": 613207\n  },\n  {\n    \"tag\": "preobedience",\n    \"popularity\": 605934\n  },\n  {\n    \"tag\": "unfriarlike",\n    \"popularity\": 598795\n  },\n  {\n    \"tag\": "microchromosome",\n    \"popularity\": 591786\n  },\n  {\n    \"tag\": "Orphicism",\n    \"popularity\": 584905\n  },\n  {\n    \"tag\": "peel",\n    \"popularity\": 578149\n  },\n  {\n    \"tag\": "obediential",\n    \"popularity\": 571514\n  },\n  {\n    \"tag\": "Peripatidea",\n    \"popularity\": 564997\n  },\n  {\n    \"tag\": "undoubtful",\n    \"popularity\": 558596\n  },\n  {\n    \"tag\": "lodgeable",\n    \"popularity\": 552307\n  },\n  {\n    \"tag\": "pustulated woodchat",\n    \"popularity\": 546129\n  },\n  {\n    \"tag\": "antepast",\n    \"popularity\": 540057\n  },\n  {\n    \"tag\": "sagittoid matrimoniously",\n    \"popularity\": 534091\n  },\n  {\n    \"tag\": "Albizzia",\n    \"popularity\": 528228\n  },\n  {\n    \"tag\": "Elateridae unnewness",\n    \"popularity\": 522464\n  },\n  {\n    \"tag\": "convertingness",\n    \"popularity\": 516798\n  },\n  {\n    \"tag\": "Pelew",\n    \"popularity\": 511228\n  },\n  {\n    \"tag\": "recapitulation",\n    \"popularity\": 505751\n  },\n  {\n    \"tag\": "shack",\n    \"popularity\": 500365\n  },\n  {\n    \"tag\": "unmellowed",\n    \"popularity\": 495069\n  },\n  {\n    \"tag\": "pavis capering",\n    \"popularity\": 489859\n  },\n  {\n    \"tag\": "fanfare",\n    \"popularity\": 484735\n  },\n  {\n    \"tag\": "sole",\n    \"popularity\": 479695\n  },\n  {\n    \"tag\": "subarcuate",\n    \"popularity\": 474735\n  },\n  {\n    \"tag\": "multivious",\n    \"popularity\": 469856\n  },\n  {\n    \"tag\": "squandermania",\n    \"popularity\": 465054\n  },\n  {\n    \"tag\": "scintle",\n    \"popularity\": 460329\n  },\n  {\n    \"tag\": "hash chirognomic",\n    \"popularity\": 455679\n  },\n  {\n    \"tag\": "linseed",\n    \"popularity\": 451101\n  },\n  {\n    \"tag\": "redoubtable",\n    \"popularity\": 446596\n  },\n  {\n    \"tag\": "poachy reimpact",\n    \"popularity\": 442160\n  },\n  {\n    \"tag\": "limestone",\n    \"popularity\": 437792\n  },\n  {\n    \"tag\": "serranid",\n    \"popularity\": 433492\n  },\n  {\n    \"tag\": "pohna",\n    \"popularity\": 429258\n  },\n  {\n    \"tag\": "warwolf",\n    \"popularity\": 425088\n  },\n  {\n    \"tag\": "ruthenous",\n    \"popularity\": 420981\n  },\n  {\n    \"tag\": "dover",\n    \"popularity\": 416935\n  },\n  {\n    \"tag\": "deuteroalbumose",\n    \"popularity\": 412950\n  },\n  {\n    \"tag\": "pseudoprophetic",\n    \"popularity\": 409025\n  },\n  {\n    \"tag\": "dissoluteness",\n    \"popularity\": 405157\n  },\n  {\n    \"tag\": "preinvention",\n    \"popularity\": 401347\n  },\n  {\n    \"tag\": "swagbellied",\n    \"popularity\": 397592\n  },\n  {\n    \"tag\": "Ophidia",\n    \"popularity\": 393892\n  },\n  {\n    \"tag\": "equanimity",\n    \"popularity\": 390245\n  },\n  {\n    \"tag\": "troutful",\n    \"popularity\": 386651\n  },\n  {\n    \"tag\": "uke",\n    \"popularity\": 383108\n  },\n  {\n    \"tag\": "preacquaint",\n    \"popularity\": 379616\n  },\n  {\n    \"tag\": "shoq",\n    \"popularity\": 376174\n  },\n  {\n    \"tag\": "yox",\n    \"popularity\": 372780\n  },\n  {\n    \"tag\": "unelemental",\n    \"popularity\": 369434\n  },\n  {\n    \"tag\": "Yavapai",\n    \"popularity\": 366134\n  },\n  {\n    \"tag\": "joulean",\n    \"popularity\": 362880\n  },\n  {\n    \"tag\": "dracontine",\n    \"popularity\": 359672\n  },\n  {\n    \"tag\": "hardmouth",\n    \"popularity\": 356507\n  },\n  {\n    \"tag\": "sylvanize",\n    \"popularity\": 353386\n  },\n  {\n    \"tag\": "intraparenchymatous meadowbur",\n    \"popularity\": 350308\n  },\n  {\n    \"tag\": "uncharily",\n    \"popularity\": 347271\n  },\n  {\n    \"tag\": "redtab flexibly",\n    \"popularity\": 344275\n  },\n  {\n    \"tag\": "centervelic",\n    \"popularity\": 341319\n  },\n  {\n    \"tag\": "unravellable",\n    \"popularity\": 338403\n  },\n  {\n    \"tag\": "infortunately",\n    \"popularity\": 335526\n  },\n  {\n    \"tag\": "cannel",\n    \"popularity\": 332687\n  },\n  {\n    \"tag\": "oxyblepsia",\n    \"popularity\": 329885\n  },\n  {\n    \"tag\": "Damon",\n    \"popularity\": 327120\n  },\n  {\n    \"tag\": "etherin",\n    \"popularity\": 324391\n  },\n  {\n    \"tag\": "luminal",\n    \"popularity\": 321697\n  },\n  {\n    \"tag\": "interrogatorily presbyte",\n    \"popularity\": 319038\n  },\n  {\n    \"tag\": "hemiclastic",\n    \"popularity\": 316414\n  },\n  {\n    \"tag\": "poh flush",\n    \"popularity\": 313823\n  },\n  {\n    \"tag\": "Psoroptes",\n    \"popularity\": 311265\n  },\n  {\n    \"tag\": "dispirit",\n    \"popularity\": 308740\n  },\n  {\n    \"tag\": "nashgab",\n    \"popularity\": 306246\n  },\n  {\n    \"tag\": "Aphidiinae",\n    \"popularity\": 303784\n  },\n  {\n    \"tag\": "rhapsody nonconstruction",\n    \"popularity\": 301353\n  },\n  {\n    \"tag\": "Osmond",\n    \"popularity\": 298952\n  },\n  {\n    \"tag\": "Leonis",\n    \"popularity\": 296581\n  },\n  {\n    \"tag\": "Lemnian",\n    \"popularity\": 294239\n  },\n  {\n    \"tag\": "acetonic gnathonic",\n    \"popularity\": 291926\n  },\n  {\n    \"tag\": "surculus",\n    \"popularity\": 289641\n  },\n  {\n    \"tag\": "diagonally",\n    \"popularity\": 287384\n  },\n  {\n    \"tag\": "counterpenalty",\n    \"popularity\": 285154\n  },\n  {\n    \"tag\": "Eugenie",\n    \"popularity\": 282952\n  },\n  {\n    \"tag\": "hornbook",\n    \"popularity\": 280776\n  },\n  {\n    \"tag\": "miscoin",\n    \"popularity\": 278626\n  },\n  {\n    \"tag\": "admi",\n    \"popularity\": 276501\n  },\n  {\n    \"tag\": "Tarmac",\n    \"popularity\": 274402\n  },\n  {\n    \"tag\": "inexplicable",\n    \"popularity\": 272328\n  },\n  {\n    \"tag\": "rascallion",\n    \"popularity\": 270278\n  },\n  {\n    \"tag\": "dusterman",\n    \"popularity\": 268252\n  },\n  {\n    \"tag\": "osteostomous unhoroscopic",\n    \"popularity\": 266250\n  },\n  {\n    \"tag\": "spinibulbar",\n    \"popularity\": 264271\n  },\n  {\n    \"tag\": "phototelegraphically",\n    \"popularity\": 262315\n  },\n  {\n    \"tag\": "Manihot",\n    \"popularity\": 260381\n  },\n  {\n    \"tag\": "neighborhood",\n    \"popularity\": 258470\n  },\n  {\n    \"tag\": "Vincetoxicum",\n    \"popularity\": 256581\n  },\n  {\n    \"tag\": "khirka",\n    \"popularity\": 254713\n  },\n  {\n    \"tag\": "conscriptive",\n    \"popularity\": 252866\n  },\n  {\n    \"tag\": "synechthran",\n    \"popularity\": 251040\n  },\n  {\n    \"tag\": "Guttiferales",\n    \"popularity\": 249235\n  },\n  {\n    \"tag\": "roomful",\n    \"popularity\": 247450\n  },\n  {\n    \"tag\": "germinal",\n    \"popularity\": 245685\n  },\n  {\n    \"tag\": "untraitorous",\n    \"popularity\": 243939\n  },\n  {\n    \"tag\": "nondissenting",\n    \"popularity\": 242213\n  },\n  {\n    \"tag\": "amotion",\n    \"popularity\": 240506\n  },\n  {\n    \"tag\": "badious",\n    \"popularity\": 238817\n  },\n  {\n    \"tag\": "sumpit",\n    \"popularity\": 237147\n  },\n  {\n    \"tag\": "ectozoic",\n    \"popularity\": 235496\n  },\n  {\n    \"tag\": "elvet",\n    \"popularity\": 233862\n  },\n  {\n    \"tag\": "underclerk",\n    \"popularity\": 232246\n  },\n  {\n    \"tag\": "reticency",\n    \"popularity\": 230647\n  },\n  {\n    \"tag\": "neutroclusion",\n    \"popularity\": 229065\n  },\n  {\n    \"tag\": "unbelieving",\n    \"popularity\": 227500\n  },\n  {\n    \"tag\": "histogenetic",\n    \"popularity\": 225952\n  },\n  {\n    \"tag\": "dermamyiasis",\n    \"popularity\": 224421\n  },\n  {\n    \"tag\": "telenergy",\n    \"popularity\": 222905\n  },\n  {\n    \"tag\": "axiomatic",\n    \"popularity\": 221406\n  },\n  {\n    \"tag\": "undominoed",\n    \"popularity\": 219922\n  },\n  {\n    \"tag\": "periosteoma",\n    \"popularity\": 218454\n  },\n  {\n    \"tag\": "justiciaryship",\n    \"popularity\": 217001\n  },\n  {\n    \"tag\": "autoluminescence",\n    \"popularity\": 215563\n  },\n  {\n    \"tag\": "osmous",\n    \"popularity\": 214140\n  },\n  {\n    \"tag\": "borgh",\n    \"popularity\": 212731\n  },\n  {\n    \"tag\": "bedebt",\n    \"popularity\": 211337\n  },\n  {\n    \"tag\": "considerableness adenoidism",\n    \"popularity\": 209957\n  },\n  {\n    \"tag\": "sailorizing",\n    \"popularity\": 208592\n  },\n  {\n    \"tag\": "Montauk",\n    \"popularity\": 207240\n  },\n  {\n    \"tag\": "Bridget",\n    \"popularity\": 205901\n  },\n  {\n    \"tag\": "Gekkota",\n    \"popularity\": 204577\n  },\n  {\n    \"tag\": "subcorymbose",\n    \"popularity\": 203265\n  },\n  {\n    \"tag\": "undersap",\n    \"popularity\": 201967\n  },\n  {\n    \"tag\": "poikilothermic",\n    \"popularity\": 200681\n  },\n  {\n    \"tag\": "enneatical",\n    \"popularity\": 199409\n  },\n  {\n    \"tag\": "martinetism",\n    \"popularity\": 198148\n  },\n  {\n    \"tag\": "sustanedly",\n    \"popularity\": 196901\n  },\n  {\n    \"tag\": "declaration",\n    \"popularity\": 195665\n  },\n  {\n    \"tag\": "myringoplasty",\n    \"popularity\": 194442\n  },\n  {\n    \"tag\": "Ginkgo",\n    \"popularity\": 193230\n  },\n  {\n    \"tag\": "unrecurrent",\n    \"popularity\": 192031\n  },\n  {\n    \"tag\": "proprecedent",\n    \"popularity\": 190843\n  },\n  {\n    \"tag\": "roadman",\n    \"popularity\": 189666\n  },\n  {\n    \"tag\": "elemin",\n    \"popularity\": 188501\n  },\n  {\n    \"tag\": "maggot",\n    \"popularity\": 187347\n  },\n  {\n    \"tag\": "alitrunk",\n    \"popularity\": 186204\n  },\n  {\n    \"tag\": "introspection",\n    \"popularity\": 185071\n  },\n  {\n    \"tag\": "batiker",\n    \"popularity\": 183950\n  },\n  {\n    \"tag\": "backhatch oversettle",\n    \"popularity\": 182839\n  },\n  {\n    \"tag\": "thresherman",\n    \"popularity\": 181738\n  },\n  {\n    \"tag\": "protemperance",\n    \"popularity\": 180648\n  },\n  {\n    \"tag\": "undern",\n    \"popularity\": 179568\n  },\n  {\n    \"tag\": "tweeg",\n    \"popularity\": 178498\n  },\n  {\n    \"tag\": "crosspath",\n    \"popularity\": 177438\n  },\n  {\n    \"tag\": "Tangaridae",\n    \"popularity\": 176388\n  },\n  {\n    \"tag\": "scrutation",\n    \"popularity\": 175348\n  },\n  {\n    \"tag\": "piecemaker",\n    \"popularity\": 174317\n  },\n  {\n    \"tag\": "paster",\n    \"popularity\": 173296\n  },\n  {\n    \"tag\": "unpretendingness",\n    \"popularity\": 172284\n  },\n  {\n    \"tag\": "inframundane",\n    \"popularity\": 171281\n  },\n  {\n    \"tag\": "kiblah",\n    \"popularity\": 170287\n  },\n  {\n    \"tag\": "playwrighting",\n    \"popularity\": 169302\n  },\n  {\n    \"tag\": "gonepoiesis snowslip",\n    \"popularity\": 168326\n  },\n  {\n    \"tag\": "hoodwise",\n    \"popularity\": 167359\n  },\n  {\n    \"tag\": "postseason",\n    \"popularity\": 166401\n  },\n  {\n    \"tag\": "equivocality",\n    \"popularity\": 165451\n  },\n  {\n    \"tag\": "Opiliaceae nuclease",\n    \"popularity\": 164509\n  },\n  {\n    \"tag\": "sextipara",\n    \"popularity\": 163576\n  },\n  {\n    \"tag\": "weeper",\n    \"popularity\": 162651\n  },\n  {\n    \"tag\": "frambesia",\n    \"popularity\": 161735\n  },\n  {\n    \"tag\": "answerable",\n    \"popularity\": 160826\n  },\n  {\n    \"tag\": "Trichosporum",\n    \"popularity\": 159925\n  },\n  {\n    \"tag\": "cajuputol",\n    \"popularity\": 159033\n  },\n  {\n    \"tag\": "pleomorphous",\n    \"popularity\": 158148\n  },\n  {\n    \"tag\": "aculeolate",\n    \"popularity\": 157270\n  },\n  {\n    \"tag\": "wherever",\n    \"popularity\": 156400\n  },\n  {\n    \"tag\": "collapse",\n    \"popularity\": 155538\n  },\n  {\n    \"tag\": "porky",\n    \"popularity\": 154683\n  },\n  {\n    \"tag\": "perule",\n    \"popularity\": 153836\n  },\n  {\n    \"tag\": "Nevada",\n    \"popularity\": 152996\n  },\n  {\n    \"tag\": "conalbumin",\n    \"popularity\": 152162\n  },\n  {\n    \"tag\": "tsunami",\n    \"popularity\": 151336\n  },\n  {\n    \"tag\": "Gulf",\n    \"popularity\": 150517\n  },\n  {\n    \"tag\": "hertz",\n    \"popularity\": 149705\n  },\n  {\n    \"tag\": "limmock",\n    \"popularity\": 148900\n  },\n  {\n    \"tag\": "Tartarize",\n    \"popularity\": 148101\n  },\n  {\n    \"tag\": "entosphenoid",\n    \"popularity\": 147310\n  },\n  {\n    \"tag\": "ibis",\n    \"popularity\": 146524\n  },\n  {\n    \"tag\": "unyeaned",\n    \"popularity\": 145746\n  },\n  {\n    \"tag\": "tritural",\n    \"popularity\": 144973\n  },\n  {\n    \"tag\": "hundredary",\n    \"popularity\": 144207\n  },\n  {\n    \"tag\": "stolonlike",\n    \"popularity\": 143448\n  },\n  {\n    \"tag\": "chorister",\n    \"popularity\": 142694\n  },\n  {\n    \"tag\": "mismove",\n    \"popularity\": 141947\n  },\n  {\n    \"tag\": "Andine",\n    \"popularity\": 141206\n  },\n  {\n    \"tag\": "Annette proneur escribe",\n    \"popularity\": 140471\n  },\n  {\n    \"tag\": "exoperidium",\n    \"popularity\": 139742\n  },\n  {\n    \"tag\": "disedge",\n    \"popularity\": 139019\n  },\n  {\n    \"tag\": "hypochloruria",\n    \"popularity\": 138302\n  },\n  {\n    \"tag\": "prepupa",\n    \"popularity\": 137590\n  },\n  {\n    \"tag\": "assent",\n    \"popularity\": 136884\n  },\n  {\n    \"tag\": "hydrazobenzene",\n    \"popularity\": 136184\n  },\n  {\n    \"tag\": "emballonurid",\n    \"popularity\": 135489\n  },\n  {\n    \"tag\": "roselle",\n    \"popularity\": 134800\n  },\n  {\n    \"tag\": "unifiedly",\n    \"popularity\": 134117\n  },\n  {\n    \"tag\": "clang",\n    \"popularity\": 133439\n  },\n  {\n    \"tag\": "acetolytic",\n    \"popularity\": 132766\n  },\n  {\n    \"tag\": "cladodont",\n    \"popularity\": 132098\n  },\n  {\n    \"tag\": "recoast",\n    \"popularity\": 131436\n  },\n  {\n    \"tag\": "celebrated tydie Eocarboniferous",\n    \"popularity\": 130779\n  },\n  {\n    \"tag\": "superconsciousness",\n    \"popularity\": 130127\n  },\n  {\n    \"tag\": "soberness",\n    \"popularity\": 129480\n  },\n  {\n    \"tag\": "panoramist",\n    \"popularity\": 128838\n  },\n  {\n    \"tag\": "Orbitolina",\n    \"popularity\": 128201\n  },\n  {\n    \"tag\": "overlewd",\n    \"popularity\": 127569\n  },\n  {\n    \"tag\": "demiquaver",\n    \"popularity\": 126942\n  },\n  {\n    \"tag\": "kamelaukion",\n    \"popularity\": 126319\n  },\n  {\n    \"tag\": "flancard",\n    \"popularity\": 125702\n  },\n  {\n    \"tag\": "tricuspid",\n    \"popularity\": 125089\n  },\n  {\n    \"tag\": "bepelt",\n    \"popularity\": 124480\n  },\n  {\n    \"tag\": "decuplet",\n    \"popularity\": 123877\n  },\n  {\n    \"tag\": "Rockies",\n    \"popularity\": 123278\n  },\n  {\n    \"tag\": "unforgeability",\n    \"popularity\": 122683\n  },\n  {\n    \"tag\": "mocha",\n    \"popularity\": 122093\n  },\n  {\n    \"tag\": "scrunge",\n    \"popularity\": 121507\n  },\n  {\n    \"tag\": "delighter",\n    \"popularity\": 120926\n  },\n  {\n    \"tag\": "willey Microtinae",\n    \"popularity\": 120349\n  },\n  {\n    \"tag\": "unhuntable",\n    \"popularity\": 119777\n  },\n  {\n    \"tag\": "historically",\n    \"popularity\": 119208\n  },\n  {\n    \"tag\": "vicegerentship",\n    \"popularity\": 118644\n  },\n  {\n    \"tag\": "hemangiosarcoma",\n    \"popularity\": 118084\n  },\n  {\n    \"tag\": "harpago",\n    \"popularity\": 117528\n  },\n  {\n    \"tag\": "unionoid",\n    \"popularity\": 116976\n  },\n  {\n    \"tag\": "wiseman",\n    \"popularity\": 116429\n  },\n  {\n    \"tag\": "diclinism",\n    \"popularity\": 115885\n  },\n  {\n    \"tag\": "Maud",\n    \"popularity\": 115345\n  },\n  {\n    \"tag\": "scaphocephalism",\n    \"popularity\": 114809\n  },\n  {\n    \"tag\": "obtenebration",\n    \"popularity\": 114277\n  },\n  {\n    \"tag\": "cymar predreadnought",\n    \"popularity\": 113749\n  },\n  {\n    \"tag\": "discommend",\n    \"popularity\": 113225\n  },\n  {\n    \"tag\": "crude",\n    \"popularity\": 112704\n  },\n  {\n    \"tag\": "upflash",\n    \"popularity\": 112187\n  },\n  {\n    \"tag\": "saltimbank",\n    \"popularity\": 111674\n  },\n  {\n    \"tag\": "posthysterical",\n    \"popularity\": 111165\n  },\n  {\n    \"tag\": "trample",\n    \"popularity\": 110659\n  },\n  {\n    \"tag\": "ungirthed",\n    \"popularity\": 110157\n  },\n  {\n    \"tag\": "unshakable",\n    \"popularity\": 109658\n  },\n  {\n    \"tag\": "hepatocystic",\n    \"popularity\": 109163\n  },\n  {\n    \"tag\": "psammophyte",\n    \"popularity\": 108671\n  },\n  {\n    \"tag\": "millionfold",\n    \"popularity\": 108183\n  },\n  {\n    \"tag\": "outtaste",\n    \"popularity\": 107698\n  },\n  {\n    \"tag\": "poppycockish",\n    \"popularity\": 107217\n  },\n  {\n    \"tag\": "viduine",\n    \"popularity\": 106739\n  },\n  {\n    \"tag\": "pleasureman",\n    \"popularity\": 106264\n  },\n  {\n    \"tag\": "cholesterolemia",\n    \"popularity\": 105792\n  },\n  {\n    \"tag\": "hostlerwife",\n    \"popularity\": 105324\n  },\n  {\n    \"tag\": "figure undergrass",\n    \"popularity\": 104859\n  },\n  {\n    \"tag\": "bedrape",\n    \"popularity\": 104398\n  },\n  {\n    \"tag\": "nuttishness",\n    \"popularity\": 103939\n  },\n  {\n    \"tag\": "fow",\n    \"popularity\": 103484\n  },\n  {\n    \"tag\": "rachianesthesia",\n    \"popularity\": 103031\n  },\n  {\n    \"tag\": "recruitable",\n    \"popularity\": 102582\n  },\n  {\n    \"tag\": "semianatomical Oenotheraceae",\n    \"popularity\": 102136\n  },\n  {\n    \"tag\": "extracapsular",\n    \"popularity\": 101693\n  },\n  {\n    \"tag\": "unsigneted",\n    \"popularity\": 101253\n  },\n  {\n    \"tag\": "fissural",\n    \"popularity\": 100816\n  },\n  {\n    \"tag\": "ayous",\n    \"popularity\": 100381\n  },\n  {\n    \"tag\": "crestfallenness odontograph",\n    \"popularity\": 99950\n  },\n  {\n    \"tag\": "monopodium",\n    \"popularity\": 99522\n  },\n  {\n    \"tag\": "germfree",\n    \"popularity\": 99096\n  },\n  {\n    \"tag\": "dauphin",\n    \"popularity\": 98673\n  },\n  {\n    \"tag\": "nonagesimal",\n    \"popularity\": 98254\n  },\n  {\n    \"tag\": "waterchat",\n    \"popularity\": 97836\n  },\n  {\n    \"tag\": "Entelodon",\n    \"popularity\": 97422\n  },\n  {\n    \"tag\": "semischolastic",\n    \"popularity\": 97010\n  },\n  {\n    \"tag\": "somata",\n    \"popularity\": 96602\n  },\n  {\n    \"tag\": "expositorily",\n    \"popularity\": 96195\n  },\n  {\n    \"tag\": "bass",\n    \"popularity\": 95792\n  },\n  {\n    \"tag\": "calorimetry",\n    \"popularity\": 95391\n  },\n  {\n    \"tag\": "entireness",\n    \"popularity\": 94993\n  },\n  {\n    \"tag\": "ratline soppiness",\n    \"popularity\": 94597\n  },\n  {\n    \"tag\": "shor",\n    \"popularity\": 94204\n  },\n  {\n    \"tag\": "coprecipitation",\n    \"popularity\": 93813\n  },\n  {\n    \"tag\": "unblushingly",\n    \"popularity\": 93425\n  },\n  {\n    \"tag\": "macarize",\n    \"popularity\": 93040\n  },\n  {\n    \"tag\": "scruplesomeness",\n    \"popularity\": 92657\n  },\n  {\n    \"tag\": "offsaddle",\n    \"popularity\": 92276\n  },\n  {\n    \"tag\": "hypertragical",\n    \"popularity\": 91898\n  },\n  {\n    \"tag\": "uncassock loined",\n    \"popularity\": 91522\n  },\n  {\n    \"tag\": "interlobate",\n    \"popularity\": 91149\n  },\n  {\n    \"tag\": "releasor orrisroot stoloniferously",\n    \"popularity\": 90778\n  },\n  {\n    \"tag\": "elementoid",\n    \"popularity\": 90410\n  },\n  {\n    \"tag\": "Lentilla",\n    \"popularity\": 90043\n  },\n  {\n    \"tag\": "distressing",\n    \"popularity\": 89679\n  },\n  {\n    \"tag\": "hydrodrome",\n    \"popularity\": 89318\n  },\n  {\n    \"tag\": "Jeannette",\n    \"popularity\": 88958\n  },\n  {\n    \"tag\": "Kuli",\n    \"popularity\": 88601\n  },\n  {\n    \"tag\": "taxinomist",\n    \"popularity\": 88246\n  },\n  {\n    \"tag\": "southwestwardly",\n    \"popularity\": 87894\n  },\n  {\n    \"tag\": "polyparia",\n    \"popularity\": 87543\n  },\n  {\n    \"tag\": "exmeridian",\n    \"popularity\": 87195\n  },\n  {\n    \"tag\": "splenius regimentaled",\n    \"popularity\": 86849\n  },\n  {\n    \"tag\": "Sphaeropsidaceae",\n    \"popularity\": 86505\n  },\n  {\n    \"tag\": "unbegun",\n    \"popularity\": 86163\n  },\n  {\n    \"tag\": "something",\n    \"popularity\": 85823\n  },\n  {\n    \"tag\": "contaminable nonexpulsion",\n    \"popularity\": 85486\n  },\n  {\n    \"tag\": "douser",\n    \"popularity\": 85150\n  },\n  {\n    \"tag\": "prostrike",\n    \"popularity\": 84817\n  },\n  {\n    \"tag\": "worky",\n    \"popularity\": 84485\n  },\n  {\n    \"tag\": "folliful",\n    \"popularity\": 84156\n  },\n  {\n    \"tag\": "prioracy",\n    \"popularity\": 83828\n  },\n  {\n    \"tag\": "undermentioned",\n    \"popularity\": 83503\n  },\n  {\n    \"tag\": "Judaica",\n    \"popularity\": 83179\n  },\n  {\n    \"tag\": "multifarious",\n    \"popularity\": 82858\n  },\n  {\n    \"tag\": "poogye",\n    \"popularity\": 82538\n  },\n  {\n    \"tag\": "Sparganium",\n    \"popularity\": 82221\n  },\n  {\n    \"tag\": "thurrock",\n    \"popularity\": 81905\n  },\n  {\n    \"tag\": "outblush",\n    \"popularity\": 81591\n  },\n  {\n    \"tag\": "Strophanthus supraordination",\n    \"popularity\": 81279\n  },\n  {\n    \"tag\": "gingerroot",\n    \"popularity\": 80969\n  },\n  {\n    \"tag\": "unconscient",\n    \"popularity\": 80661\n  },\n  {\n    \"tag\": "unconstitutionally",\n    \"popularity\": 80354\n  },\n  {\n    \"tag\": "plaguily",\n    \"popularity\": 80050\n  },\n  {\n    \"tag\": "waterily equatorwards",\n    \"popularity\": 79747\n  },\n  {\n    \"tag\": "nondeposition",\n    \"popularity\": 79446\n  },\n  {\n    \"tag\": "dronishly",\n    \"popularity\": 79147\n  },\n  {\n    \"tag\": "gateado",\n    \"popularity\": 78849\n  },\n  {\n    \"tag\": "dislink",\n    \"popularity\": 78553\n  },\n  {\n    \"tag\": "Joceline",\n    \"popularity\": 78259\n  },\n  {\n    \"tag\": "amphiboliferous",\n    \"popularity\": 77967\n  },\n  {\n    \"tag\": "bushrope",\n    \"popularity\": 77676\n  },\n  {\n    \"tag\": "plumicorn sulphosalicylic",\n    \"popularity\": 77387\n  },\n  {\n    \"tag\": "nonefficiency",\n    \"popularity\": 77100\n  },\n  {\n    \"tag\": "hieroscopy",\n    \"popularity\": 76815\n  },\n  {\n    \"tag\": "causativeness",\n    \"popularity\": 76531\n  },\n  {\n    \"tag\": "swird paleoeremology",\n    \"popularity\": 76249\n  },\n  {\n    \"tag\": "camphoric",\n    \"popularity\": 75968\n  },\n  {\n    \"tag\": "retaining",\n    \"popularity\": 75689\n  },\n  {\n    \"tag\": "thyreoprotein",\n    \"popularity\": 75411\n  },\n  {\n    \"tag\": "carbona",\n    \"popularity\": 75136\n  },\n  {\n    \"tag\": "protectively",\n    \"popularity\": 74861\n  },\n  {\n    \"tag\": "mosasaur",\n    \"popularity\": 74589\n  },\n  {\n    \"tag\": "reciprocator",\n    \"popularity\": 74317\n  },\n  {\n    \"tag\": "detentive",\n    \"popularity\": 74048\n  },\n  {\n    \"tag\": "supravital",\n    \"popularity\": 73780\n  },\n  {\n    \"tag\": "Vespertilionidae",\n    \"popularity\": 73513\n  },\n  {\n    \"tag\": "parka",\n    \"popularity\": 73248\n  },\n  {\n    \"tag\": "pickaway",\n    \"popularity\": 72984\n  },\n  {\n    \"tag\": "oleaceous",\n    \"popularity\": 72722\n  },\n  {\n    \"tag\": "anticogitative",\n    \"popularity\": 72462\n  },\n  {\n    \"tag\": "woe",\n    \"popularity\": 72203\n  },\n  {\n    \"tag\": "skeuomorph",\n    \"popularity\": 71945\n  },\n  {\n    \"tag\": "helpmeet",\n    \"popularity\": 71689\n  },\n  {\n    \"tag\": "Hexactinellida brickmaking",\n    \"popularity\": 71434\n  },\n  {\n    \"tag\": "resink",\n    \"popularity\": 71180\n  },\n  {\n    \"tag\": "diluter",\n    \"popularity\": 70928\n  },\n  {\n    \"tag\": "micromicron",\n    \"popularity\": 70677\n  },\n  {\n    \"tag\": "parentage",\n    \"popularity\": 70428\n  },\n  {\n    \"tag\": "galactorrhoea",\n    \"popularity\": 70180\n  },\n  {\n    \"tag\": "gey",\n    \"popularity\": 69934\n  },\n  {\n    \"tag\": "gesticulatory",\n    \"popularity\": 69689\n  },\n  {\n    \"tag\": "wergil",\n    \"popularity\": 69445\n  },\n  {\n    \"tag\": "Lecanora",\n    \"popularity\": 69202\n  },\n  {\n    \"tag\": "malanders karst",\n    \"popularity\": 68961\n  },\n  {\n    \"tag\": "vibetoite",\n    \"popularity\": 68721\n  },\n  {\n    \"tag\": "unrequitedness",\n    \"popularity\": 68483\n  },\n  {\n    \"tag\": "outwash",\n    \"popularity\": 68245\n  },\n  {\n    \"tag\": "unsacred",\n    \"popularity\": 68009\n  },\n  {\n    \"tag\": "unabetted dividend",\n    \"popularity\": 67775\n  },\n  {\n    \"tag\": "untraveling",\n    \"popularity\": 67541\n  },\n  {\n    \"tag\": "thermobattery",\n    \"popularity\": 67309\n  },\n  {\n    \"tag\": "polypragmist",\n    \"popularity\": 67078\n  },\n  {\n    \"tag\": "irrefutableness",\n    \"popularity\": 66848\n  },\n  {\n    \"tag\": "remiges",\n    \"popularity\": 66620\n  },\n  {\n    \"tag\": "implode",\n    \"popularity\": 66393\n  },\n  {\n    \"tag\": "superfluousness",\n    \"popularity\": 66166\n  },\n  {\n    \"tag\": "croakily unalleviated",\n    \"popularity\": 65942\n  },\n  {\n    \"tag\": "edicule",\n    \"popularity\": 65718\n  },\n  {\n    \"tag\": "entophytous",\n    \"popularity\": 65495\n  },\n  {\n    \"tag\": "benefactorship Toryish",\n    \"popularity\": 65274\n  },\n  {\n    \"tag\": "pseudoamateurish",\n    \"popularity\": 65054\n  },\n  {\n    \"tag\": "flueless Iguanodontoidea snipnose",\n    \"popularity\": 64835\n  },\n  {\n    \"tag\": "zealotical Zamicrus interpole",\n    \"popularity\": 64617\n  },\n  {\n    \"tag\": "whereabout",\n    \"popularity\": 64401\n  },\n  {\n    \"tag\": "benzazide",\n    \"popularity\": 64185\n  },\n  {\n    \"tag\": "pokeweed",\n    \"popularity\": 63971\n  },\n  {\n    \"tag\": "calamitoid",\n    \"popularity\": 63757\n  },\n  {\n    \"tag\": "sporozoal",\n    \"popularity\": 63545\n  },\n  {\n    \"tag\": "physcioid Welshwoman",\n    \"popularity\": 63334\n  },\n  {\n    \"tag\": "wanting",\n    \"popularity\": 63124\n  },\n  {\n    \"tag\": "unencumbering",\n    \"popularity\": 62915\n  },\n  {\n    \"tag\": "Tupi",\n    \"popularity\": 62707\n  },\n  {\n    \"tag\": "potbank",\n    \"popularity\": 62501\n  },\n  {\n    \"tag\": "bulked",\n    \"popularity\": 62295\n  },\n  {\n    \"tag\": "uparise",\n    \"popularity\": 62090\n  },\n  {\n    \"tag\": "Sudra",\n    \"popularity\": 61887\n  },\n  {\n    \"tag\": "hyperscrupulosity",\n    \"popularity\": 61684\n  },\n  {\n    \"tag\": "subterraneously unmaid",\n    \"popularity\": 61483\n  },\n  {\n    \"tag\": "poisonousness",\n    \"popularity\": 61282\n  },\n  {\n    \"tag\": "phare",\n    \"popularity\": 61083\n  },\n  {\n    \"tag\": "dicynodont",\n    \"popularity\": 60884\n  },\n  {\n    \"tag\": "chewer",\n    \"popularity\": 60687\n  },\n  {\n    \"tag\": "uliginous",\n    \"popularity\": 60490\n  },\n  {\n    \"tag\": "tinman",\n    \"popularity\": 60295\n  },\n  {\n    \"tag\": "coconut",\n    \"popularity\": 60100\n  },\n  {\n    \"tag\": "phryganeoid",\n    \"popularity\": 59907\n  },\n  {\n    \"tag\": "bismillah",\n    \"popularity\": 59714\n  },\n  {\n    \"tag\": "tautomeric",\n    \"popularity\": 59523\n  },\n  {\n    \"tag\": "jerquer",\n    \"popularity\": 59332\n  },\n  {\n    \"tag\": "Dryopithecinae",\n    \"popularity\": 59143\n  },\n  {\n    \"tag\": "ghizite",\n    \"popularity\": 58954\n  },\n  {\n    \"tag\": "unliveable",\n    \"popularity\": 58766\n  },\n  {\n    \"tag\": "craftsmaster",\n    \"popularity\": 58579\n  },\n  {\n    \"tag\": "semiscenic",\n    \"popularity\": 58394\n  },\n  {\n    \"tag\": "danaid",\n    \"popularity\": 58209\n  },\n  {\n    \"tag\": "flawful",\n    \"popularity\": 58025\n  },\n  {\n    \"tag\": "risibleness",\n    \"popularity\": 57841\n  },\n  {\n    \"tag\": "Muscovite",\n    \"popularity\": 57659\n  },\n  {\n    \"tag\": "snaringly",\n    \"popularity\": 57478\n  },\n  {\n    \"tag\": "brilliantwise",\n    \"popularity\": 57297\n  },\n  {\n    \"tag\": "plebeity",\n    \"popularity\": 57118\n  },\n  {\n    \"tag\": "historicalness",\n    \"popularity\": 56939\n  },\n  {\n    \"tag\": "piecemeal",\n    \"popularity\": 56761\n  },\n  {\n    \"tag\": "maxillipedary",\n    \"popularity\": 56584\n  },\n  {\n    \"tag\": "Hypenantron",\n    \"popularity\": 56408\n  },\n  {\n    \"tag\": "quaintness avigate",\n    \"popularity\": 56233\n  },\n  {\n    \"tag\": "ave",\n    \"popularity\": 56059\n  },\n  {\n    \"tag\": "mediaevally",\n    \"popularity\": 55885\n  },\n  {\n    \"tag\": "brucite",\n    \"popularity\": 55712\n  },\n  {\n    \"tag\": "Schwendenerian",\n    \"popularity\": 55541\n  },\n  {\n    \"tag\": "julole",\n    \"popularity\": 55370\n  },\n  {\n    \"tag\": "palaeolith",\n    \"popularity\": 55199\n  },\n  {\n    \"tag\": "cotyledonary",\n    \"popularity\": 55030\n  },\n  {\n    \"tag\": "rond",\n    \"popularity\": 54861\n  },\n  {\n    \"tag\": "boomster tassoo",\n    \"popularity\": 54694\n  },\n  {\n    \"tag\": "cattishly",\n    \"popularity\": 54527\n  },\n  {\n    \"tag\": "tonguefence",\n    \"popularity\": 54360\n  },\n  {\n    \"tag\": "hexastylar triskele",\n    \"popularity\": 54195\n  },\n  {\n    \"tag\": "ariot",\n    \"popularity\": 54030\n  },\n  {\n    \"tag\": "intarsist",\n    \"popularity\": 53867\n  },\n  {\n    \"tag\": "Oscines",\n    \"popularity\": 53704\n  },\n  {\n    \"tag\": "Spaniolize",\n    \"popularity\": 53541\n  },\n  {\n    \"tag\": "smellfungus",\n    \"popularity\": 53380\n  },\n  {\n    \"tag\": "redisplay",\n    \"popularity\": 53219\n  },\n  {\n    \"tag\": "phosphene",\n    \"popularity\": 53059\n  },\n  {\n    \"tag\": "phycomycete",\n    \"popularity\": 52900\n  },\n  {\n    \"tag\": "prophetic",\n    \"popularity\": 52741\n  },\n  {\n    \"tag\": "overtrustful",\n    \"popularity\": 52584\n  },\n  {\n    \"tag\": "pinitol",\n    \"popularity\": 52427\n  },\n  {\n    \"tag\": "asthmatic",\n    \"popularity\": 52270\n  },\n  {\n    \"tag\": "convulsive",\n    \"popularity\": 52115\n  },\n  {\n    \"tag\": "draughtswoman",\n    \"popularity\": 51960\n  },\n  {\n    \"tag\": "unetymologizable",\n    \"popularity\": 51806\n  },\n  {\n    \"tag\": "centrarchoid",\n    \"popularity\": 51652\n  },\n  {\n    \"tag\": "mesioincisal",\n    \"popularity\": 51500\n  },\n  {\n    \"tag\": "transbaikal",\n    \"popularity\": 51348\n  },\n  {\n    \"tag\": "silveriness",\n    \"popularity\": 51196\n  },\n  {\n    \"tag\": "costotomy",\n    \"popularity\": 51046\n  },\n  {\n    \"tag\": "caracore",\n    \"popularity\": 50896\n  },\n  {\n    \"tag\": "depotentiation",\n    \"popularity\": 50747\n  },\n  {\n    \"tag\": "glossoepiglottidean",\n    \"popularity\": 50598\n  },\n  {\n    \"tag\": "upswell",\n    \"popularity\": 50450\n  },\n  {\n    \"tag\": "flecnodal",\n    \"popularity\": 50303\n  },\n  {\n    \"tag\": "coventrate",\n    \"popularity\": 50157\n  },\n  {\n    \"tag\": "duchesse",\n    \"popularity\": 50011\n  },\n  {\n    \"tag\": "excisemanship trophied",\n    \"popularity\": 49866\n  },\n  {\n    \"tag\": "cytinaceous",\n    \"popularity\": 49721\n  },\n  {\n    \"tag\": "assuringly",\n    \"popularity\": 49577\n  },\n  {\n    \"tag\": "unconducted upliftitis",\n    \"popularity\": 49434\n  },\n  {\n    \"tag\": "rachicentesis",\n    \"popularity\": 49292\n  },\n  {\n    \"tag\": "antiangular",\n    \"popularity\": 49150\n  },\n  {\n    \"tag\": "advisal",\n    \"popularity\": 49008\n  },\n  {\n    \"tag\": "birdcatcher",\n    \"popularity\": 48868\n  },\n  {\n    \"tag\": "secularistic",\n    \"popularity\": 48728\n  },\n  {\n    \"tag\": "grandeeism superinformal",\n    \"popularity\": 48588\n  },\n  {\n    \"tag\": "unapprehension",\n    \"popularity\": 48449\n  },\n  {\n    \"tag\": "excipulum",\n    \"popularity\": 48311\n  },\n  {\n    \"tag\": "decimole",\n    \"popularity\": 48174\n  },\n  {\n    \"tag\": "semidrachm",\n    \"popularity\": 48037\n  },\n  {\n    \"tag\": "uvulotome",\n    \"popularity\": 47901\n  },\n  {\n    \"tag\": "Lemaneaceae",\n    \"popularity\": 47765\n  },\n  {\n    \"tag\": "corrade",\n    \"popularity\": 47630\n  },\n  {\n    \"tag\": "Kuroshio",\n    \"popularity\": 47495\n  },\n  {\n    \"tag\": "Araliophyllum",\n    \"popularity\": 47361\n  },\n  {\n    \"tag\": "victoriousness cardiosphygmograph",\n    \"popularity\": 47228\n  },\n  {\n    \"tag\": "reinvent",\n    \"popularity\": 47095\n  },\n  {\n    \"tag\": "Macrotolagus",\n    \"popularity\": 46963\n  },\n  {\n    \"tag\": "strenuousness",\n    \"popularity\": 46831\n  },\n  {\n    \"tag\": "deviability",\n    \"popularity\": 46700\n  },\n  {\n    \"tag\": "phyllospondylous",\n    \"popularity\": 46570\n  },\n  {\n    \"tag\": "bisect rudderhole",\n    \"popularity\": 46440\n  },\n  {\n    \"tag\": "crownwork",\n    \"popularity\": 46311\n  },\n  {\n    \"tag\": "Ascalabota",\n    \"popularity\": 46182\n  },\n  {\n    \"tag\": "prostatomyomectomy",\n    \"popularity\": 46054\n  },\n  {\n    \"tag\": "neurosyphilis",\n    \"popularity\": 45926\n  },\n  {\n    \"tag\": "tabloid scraplet",\n    \"popularity\": 45799\n  },\n  {\n    \"tag\": "nonmedullated servility",\n    \"popularity\": 45673\n  },\n  {\n    \"tag\": "melopoeic practicalization",\n    \"popularity\": 45547\n  },\n  {\n    \"tag\": "nonrhythmic",\n    \"popularity\": 45421\n  },\n  {\n    \"tag\": "deplorer",\n    \"popularity\": 45296\n  },\n  {\n    \"tag\": "Ophion",\n    \"popularity\": 45172\n  },\n  {\n    \"tag\": "subprioress",\n    \"popularity\": 45048\n  },\n  {\n    \"tag\": "semiregular",\n    \"popularity\": 44925\n  },\n  {\n    \"tag\": "praelection",\n    \"popularity\": 44802\n  },\n  {\n    \"tag\": "discinct",\n    \"popularity\": 44680\n  },\n  {\n    \"tag\": "preplace",\n    \"popularity\": 44558\n  },\n  {\n    \"tag\": "paternoster",\n    \"popularity\": 44437\n  },\n  {\n    \"tag\": "suboccipital",\n    \"popularity\": 44316\n  },\n  {\n    \"tag\": "Teutophil",\n    \"popularity\": 44196\n  },\n  {\n    \"tag\": "tracheole",\n    \"popularity\": 44076\n  },\n  {\n    \"tag\": "subsmile",\n    \"popularity\": 43957\n  },\n  {\n    \"tag\": "nonapostatizing",\n    \"popularity\": 43839\n  },\n  {\n    \"tag\": "cleidotomy",\n    \"popularity\": 43720\n  },\n  {\n    \"tag\": "hingle",\n    \"popularity\": 43603\n  },\n  {\n    \"tag\": "jocoque",\n    \"popularity\": 43486\n  },\n  {\n    \"tag\": "trundler notidanian",\n    \"popularity\": 43369\n  },\n  {\n    \"tag\": "strangling misdaub",\n    \"popularity\": 43253\n  },\n  {\n    \"tag\": "noncancellable",\n    \"popularity\": 43137\n  },\n  {\n    \"tag\": "lavabo",\n    \"popularity\": 43022\n  },\n  {\n    \"tag\": "lanterloo",\n    \"popularity\": 42907\n  },\n  {\n    \"tag\": "uncitizenly",\n    \"popularity\": 42793\n  },\n  {\n    \"tag\": "autoturning",\n    \"popularity\": 42679\n  },\n  {\n    \"tag\": "Haganah",\n    \"popularity\": 42566\n  },\n  {\n    \"tag\": "Glecoma",\n    \"popularity\": 42453\n  },\n  {\n    \"tag\": "membered",\n    \"popularity\": 42341\n  },\n  {\n    \"tag\": "consuetudinal",\n    \"popularity\": 42229\n  },\n  {\n    \"tag\": "gatehouse",\n    \"popularity\": 42117\n  },\n  {\n    \"tag\": "tetherball",\n    \"popularity\": 42006\n  },\n  {\n    \"tag\": "counterrevolutionist numismatical",\n    \"popularity\": 41896\n  },\n  {\n    \"tag\": "pagehood plateiasmus",\n    \"popularity\": 41786\n  },\n  {\n    \"tag\": "pelterer",\n    \"popularity\": 41676\n  },\n  {\n    \"tag\": "splenemphraxis",\n    \"popularity\": 41567\n  },\n  {\n    \"tag\": "Crypturidae",\n    \"popularity\": 41458\n  },\n  {\n    \"tag\": "caboodle",\n    \"popularity\": 41350\n  },\n  {\n    \"tag\": "Filaria",\n    \"popularity\": 41242\n  },\n  {\n    \"tag\": "noninvincibility",\n    \"popularity\": 41135\n  },\n  {\n    \"tag\": "preadvertisement",\n    \"popularity\": 41028\n  },\n  {\n    \"tag\": "bathrobe",\n    \"popularity\": 40921\n  },\n  {\n    \"tag\": "nitrifier",\n    \"popularity\": 40815\n  },\n  {\n    \"tag\": "furthermore",\n    \"popularity\": 40709\n  },\n  {\n    \"tag\": "recrate",\n    \"popularity\": 40604\n  },\n  {\n    \"tag\": "inexist",\n    \"popularity\": 40499\n  },\n  {\n    \"tag\": "Mocoan",\n    \"popularity\": 40395\n  },\n  {\n    \"tag\": "forint",\n    \"popularity\": 40291\n  },\n  {\n    \"tag\": "cardiomyoliposis",\n    \"popularity\": 40187\n  },\n  {\n    \"tag\": "channeling",\n    \"popularity\": 40084\n  },\n  {\n    \"tag\": "quebrachine",\n    \"popularity\": 39981\n  },\n  {\n    \"tag\": "magistery",\n    \"popularity\": 39879\n  },\n  {\n    \"tag\": "koko",\n    \"popularity\": 39777\n  },\n  {\n    \"tag\": "nobilify",\n    \"popularity\": 39676\n  },\n  {\n    \"tag\": "articulate taprooted",\n    \"popularity\": 39575\n  },\n  {\n    \"tag\": "cardiotonic Nicaragua",\n    \"popularity\": 39474\n  },\n  {\n    \"tag\": "assertiveness",\n    \"popularity\": 39374\n  },\n  {\n    \"tag\": "springtail",\n    \"popularity\": 39274\n  },\n  {\n    \"tag\": "spontoon",\n    \"popularity\": 39174\n  },\n  {\n    \"tag\": "plesiobiosis",\n    \"popularity\": 39075\n  },\n  {\n    \"tag\": "rooinek",\n    \"popularity\": 38976\n  },\n  {\n    \"tag\": "hairif falsehood",\n    \"popularity\": 38878\n  },\n  {\n    \"tag\": "synodally",\n    \"popularity\": 38780\n  },\n  {\n    \"tag\": "biodynamics",\n    \"popularity\": 38683\n  },\n  {\n    \"tag\": "trickling",\n    \"popularity\": 38585\n  },\n  {\n    \"tag\": "oxfly daystar",\n    \"popularity\": 38489\n  },\n  {\n    \"tag\": "epicycloidal",\n    \"popularity\": 38392\n  },\n  {\n    \"tag\": "shorthand",\n    \"popularity\": 38296\n  },\n  {\n    \"tag\": "herpolhode",\n    \"popularity\": 38201\n  },\n  {\n    \"tag\": "polysynthesism",\n    \"popularity\": 38105\n  },\n  {\n    \"tag\": "cany",\n    \"popularity\": 38010\n  },\n  {\n    \"tag\": "sideage",\n    \"popularity\": 37916\n  },\n  {\n    \"tag\": "strainableness",\n    \"popularity\": 37822\n  },\n  {\n    \"tag\": "superformidable",\n    \"popularity\": 37728\n  },\n  {\n    \"tag\": "slendang",\n    \"popularity\": 37634\n  },\n  {\n    \"tag\": "impropriation",\n    \"popularity\": 37541\n  },\n  {\n    \"tag\": "ficklehearted",\n    \"popularity\": 37449\n  },\n  {\n    \"tag\": "wintrify",\n    \"popularity\": 37356\n  },\n  {\n    \"tag\": "geomorphogenist",\n    \"popularity\": 37264\n  },\n  {\n    \"tag\": "smuggleable",\n    \"popularity\": 37173\n  },\n  {\n    \"tag\": "delapsion",\n    \"popularity\": 37081\n  },\n  {\n    \"tag\": "projective",\n    \"popularity\": 36990\n  },\n  {\n    \"tag\": "unglue exfoliation",\n    \"popularity\": 36900\n  },\n  {\n    \"tag\": "Acerae",\n    \"popularity\": 36810\n  },\n  {\n    \"tag\": "unstaged",\n    \"popularity\": 36720\n  },\n  {\n    \"tag\": "ranal",\n    \"popularity\": 36630\n  },\n  {\n    \"tag\": "worrier",\n    \"popularity\": 36541\n  },\n  {\n    \"tag\": "unhid",\n    \"popularity\": 36452\n  },\n  {\n    \"tag\": "adequation",\n    \"popularity\": 36363\n  },\n  {\n    \"tag\": "strongylid Sokotri",\n    \"popularity\": 36275\n  },\n  {\n    \"tag\": "fumingly",\n    \"popularity\": 36187\n  },\n  {\n    \"tag\": "gynosporangium phaenogenetic",\n    \"popularity\": 36100\n  },\n  {\n    \"tag\": "uniunguiculate",\n    \"popularity\": 36012\n  },\n  {\n    \"tag\": "prudelike",\n    \"popularity\": 35926\n  },\n  {\n    \"tag\": "seminomata",\n    \"popularity\": 35839\n  },\n  {\n    \"tag\": "trinklet",\n    \"popularity\": 35753\n  },\n  {\n    \"tag\": "risorial",\n    \"popularity\": 35667\n  },\n  {\n    \"tag\": "pericardiocentesis",\n    \"popularity\": 35581\n  },\n  {\n    \"tag\": "filmist",\n    \"popularity\": 35496\n  },\n  {\n    \"tag\": "Nana",\n    \"popularity\": 35411\n  },\n  {\n    \"tag\": "cynipoid",\n    \"popularity\": 35326\n  },\n  {\n    \"tag\": "cteniform",\n    \"popularity\": 35242\n  },\n  {\n    \"tag\": "semiflex",\n    \"popularity\": 35158\n  },\n  {\n    \"tag\": "solstitially",\n    \"popularity\": 35074\n  },\n  {\n    \"tag\": "Algarsife",\n    \"popularity\": 34991\n  },\n  {\n    \"tag\": "noncriminal",\n    \"popularity\": 34908\n  },\n  {\n    \"tag\": "compassion",\n    \"popularity\": 34825\n  },\n  {\n    \"tag\": "Buddhic",\n    \"popularity\": 34743\n  },\n  {\n    \"tag\": "vellicative dactylically hotfoot",\n    \"popularity\": 34661\n  },\n  {\n    \"tag\": "chicory",\n    \"popularity\": 34579\n  },\n  {\n    \"tag\": "transperitoneally",\n    \"popularity\": 34497\n  },\n  {\n    \"tag\": "pennae",\n    \"popularity\": 34416\n  },\n  {\n    \"tag\": "Flamandize",\n    \"popularity\": 34335\n  },\n  {\n    \"tag\": "underviewer",\n    \"popularity\": 34254\n  },\n  {\n    \"tag\": "assoil",\n    \"popularity\": 34174\n  },\n  {\n    \"tag\": "saccharobacillus",\n    \"popularity\": 34094\n  },\n  {\n    \"tag\": "biacetylene",\n    \"popularity\": 34014\n  },\n  {\n    \"tag\": "mouchardism",\n    \"popularity\": 33935\n  },\n  {\n    \"tag\": "anisomeric",\n    \"popularity\": 33856\n  },\n  {\n    \"tag\": "digestive",\n    \"popularity\": 33777\n  },\n  {\n    \"tag\": "darlingly",\n    \"popularity\": 33698\n  },\n  {\n    \"tag\": "liman",\n    \"popularity\": 33620\n  },\n  {\n    \"tag\": "soldanrie",\n    \"popularity\": 33542\n  },\n  {\n    \"tag\": "sully",\n    \"popularity\": 33464\n  },\n  {\n    \"tag\": "brightsmith",\n    \"popularity\": 33387\n  },\n  {\n    \"tag\": "inwrap antiliturgist ureterocervical",\n    \"popularity\": 33309\n  },\n  {\n    \"tag\": "discommodity",\n    \"popularity\": 33232\n  },\n  {\n    \"tag\": "typical aggrandizer",\n    \"popularity\": 33156\n  },\n  {\n    \"tag\": "xenogeny",\n    \"popularity\": 33079\n  },\n  {\n    \"tag\": "uncountrified",\n    \"popularity\": 33003\n  },\n  {\n    \"tag\": "Podarge",\n    \"popularity\": 32928\n  },\n  {\n    \"tag\": "uninterviewed",\n    \"popularity\": 32852\n  },\n  {\n    \"tag\": "underprior",\n    \"popularity\": 32777\n  },\n  {\n    \"tag\": "leiomyomatous",\n    \"popularity\": 32702\n  },\n  {\n    \"tag\": "postdysenteric",\n    \"popularity\": 32627\n  },\n  {\n    \"tag\": "Fusicladium",\n    \"popularity\": 32553\n  },\n  {\n    \"tag\": "Dulcinea",\n    \"popularity\": 32478\n  },\n  {\n    \"tag\": "interspersion",\n    \"popularity\": 32404\n  },\n  {\n    \"tag\": "preobligate",\n    \"popularity\": 32331\n  },\n  {\n    \"tag\": "subaggregate",\n    \"popularity\": 32257\n  },\n  {\n    \"tag\": "grammarianism",\n    \"popularity\": 32184\n  },\n  {\n    \"tag\": "palikar",\n    \"popularity\": 32111\n  },\n  {\n    \"tag\": "facileness",\n    \"popularity\": 32039\n  },\n  {\n    \"tag\": "deuterofibrinose",\n    \"popularity\": 31966\n  },\n  {\n    \"tag\": "pseudesthesia",\n    \"popularity\": 31894\n  },\n  {\n    \"tag\": "sedimentary",\n    \"popularity\": 31822\n  },\n  {\n    \"tag\": "typewrite",\n    \"popularity\": 31751\n  },\n  {\n    \"tag\": "immemorable",\n    \"popularity\": 31679\n  },\n  {\n    \"tag\": "Myrtus",\n    \"popularity\": 31608\n  },\n  {\n    \"tag\": "hauchecornite",\n    \"popularity\": 31537\n  },\n  {\n    \"tag\": "galleylike",\n    \"popularity\": 31467\n  },\n  {\n    \"tag\": "thimber",\n    \"popularity\": 31396\n  },\n  {\n    \"tag\": "Hegelianism",\n    \"popularity\": 31326\n  },\n  {\n    \"tag\": "strig",\n    \"popularity\": 31256\n  },\n  {\n    \"tag\": "skyre",\n    \"popularity\": 31187\n  },\n  {\n    \"tag\": "eupepticism",\n    \"popularity\": 31117\n  },\n  {\n    \"tag\": "eponymism",\n    \"popularity\": 31048\n  },\n  {\n    \"tag\": "flunkeyhood",\n    \"popularity\": 30979\n  },\n  {\n    \"tag\": "Abama",\n    \"popularity\": 30911\n  },\n  {\n    \"tag\": "adiadochokinesis",\n    \"popularity\": 30842\n  },\n  {\n    \"tag\": "spendthrifty",\n    \"popularity\": 30774\n  },\n  {\n    \"tag\": "chalcedony",\n    \"popularity\": 30706\n  },\n  {\n    \"tag\": "authorism",\n    \"popularity\": 30638\n  },\n  {\n    \"tag\": "nasturtium",\n    \"popularity\": 30571\n  },\n  {\n    \"tag\": "Acanthocereus",\n    \"popularity\": 30504\n  },\n  {\n    \"tag\": "uncollapsible",\n    \"popularity\": 30437\n  },\n  {\n    \"tag\": "excursionist",\n    \"popularity\": 30370\n  },\n  {\n    \"tag\": "fogbow",\n    \"popularity\": 30303\n  },\n  {\n    \"tag\": "overlie",\n    \"popularity\": 30237\n  },\n  {\n    \"tag\": "velours",\n    \"popularity\": 30171\n  },\n  {\n    \"tag\": "zoodendria madrigal stagbush",\n    \"popularity\": 30105\n  },\n  {\n    \"tag\": "imi",\n    \"popularity\": 30039\n  },\n  {\n    \"tag\": "cojudge",\n    \"popularity\": 29974\n  },\n  {\n    \"tag\": "depurate argal",\n    \"popularity\": 29909\n  },\n  {\n    \"tag\": "unrecognition",\n    \"popularity\": 29844\n  },\n  {\n    \"tag\": "paunchful",\n    \"popularity\": 29779\n  },\n  {\n    \"tag\": "invalued",\n    \"popularity\": 29714\n  },\n  {\n    \"tag\": "probang",\n    \"popularity\": 29650\n  },\n  {\n    \"tag\": "chetvert",\n    \"popularity\": 29586\n  },\n  {\n    \"tag\": "enactable",\n    \"popularity\": 29522\n  },\n  {\n    \"tag\": "detoxicate adhibit",\n    \"popularity\": 29458\n  },\n  {\n    \"tag\": "kullaite",\n    \"popularity\": 29395\n  },\n  {\n    \"tag\": "undazzling",\n    \"popularity\": 29332\n  },\n  {\n    \"tag\": "excalation",\n    \"popularity\": 29269\n  },\n  {\n    \"tag\": "sievings",\n    \"popularity\": 29206\n  },\n  {\n    \"tag\": "disenthral",\n    \"popularity\": 29143\n  },\n  {\n    \"tag\": "disinterestedly",\n    \"popularity\": 29081\n  },\n  {\n    \"tag\": "stanner",\n    \"popularity\": 29018\n  },\n  {\n    \"tag\": "recapitulative",\n    \"popularity\": 28956\n  },\n  {\n    \"tag\": "objectivist",\n    \"popularity\": 28895\n  },\n  {\n    \"tag\": "hypermetropia",\n    \"popularity\": 28833\n  },\n  {\n    \"tag\": "incumbency",\n    \"popularity\": 28772\n  },\n  {\n    \"tag\": "protegee",\n    \"popularity\": 28711\n  },\n  {\n    \"tag\": "zealotic",\n    \"popularity\": 28650\n  },\n  {\n    \"tag\": "predebit",\n    \"popularity\": 28589\n  },\n  {\n    \"tag\": "cupolar",\n    \"popularity\": 28528\n  },\n  {\n    \"tag\": "unattributed",\n    \"popularity\": 28468\n  },\n  {\n    \"tag\": "louisine",\n    \"popularity\": 28408\n  },\n  {\n    \"tag\": "illustrate",\n    \"popularity\": 28348\n  },\n  {\n    \"tag\": "inofficiousness",\n    \"popularity\": 28288\n  },\n  {\n    \"tag\": "Americawards",\n    \"popularity\": 28228\n  },\n  {\n    \"tag\": "foreflap",\n    \"popularity\": 28169\n  },\n  {\n    \"tag\": "eruditeness",\n    \"popularity\": 28110\n  },\n  {\n    \"tag\": "copiopsia",\n    \"popularity\": 28051\n  },\n  {\n    \"tag\": "sporuliferous",\n    \"popularity\": 27992\n  },\n  {\n    \"tag\": "muttering",\n    \"popularity\": 27934\n  },\n  {\n    \"tag\": "prepsychology adrip",\n    \"popularity\": 27875\n  },\n  {\n    \"tag\": "unfriendly",\n    \"popularity\": 27817\n  },\n  {\n    \"tag\": "sulphanilic",\n    \"popularity\": 27759\n  },\n  {\n    \"tag\": "Coelococcus",\n    \"popularity\": 27701\n  },\n  {\n    \"tag\": "undoubtfulness",\n    \"popularity\": 27643\n  },\n  {\n    \"tag\": "flaringly",\n    \"popularity\": 27586\n  },\n  {\n    \"tag\": "unordain",\n    \"popularity\": 27529\n  },\n  {\n    \"tag\": "fratchety",\n    \"popularity\": 27472\n  },\n  {\n    \"tag\": "decadentism dolefully",\n    \"popularity\": 27415\n  },\n  {\n    \"tag\": "synthronus",\n    \"popularity\": 27358\n  },\n  {\n    \"tag\": "maiid",\n    \"popularity\": 27301\n  },\n  {\n    \"tag\": "rhinobyon",\n    \"popularity\": 27245\n  },\n  {\n    \"tag\": "Didynamia",\n    \"popularity\": 27189\n  },\n  {\n    \"tag\": "millionairedom",\n    \"popularity\": 27133\n  },\n  {\n    \"tag\": "mulierine",\n    \"popularity\": 27077\n  },\n  {\n    \"tag\": "Mayo",\n    \"popularity\": 27021\n  },\n  {\n    \"tag\": "perceivedness",\n    \"popularity\": 26966\n  },\n  {\n    \"tag\": "unadoration",\n    \"popularity\": 26911\n  },\n  {\n    \"tag\": "regraft",\n    \"popularity\": 26856\n  },\n  {\n    \"tag\": "witch",\n    \"popularity\": 26801\n  },\n  {\n    \"tag\": "ungrow",\n    \"popularity\": 26746\n  },\n  {\n    \"tag\": "glossopharyngeus",\n    \"popularity\": 26691\n  },\n  {\n    \"tag\": "unstirrable",\n    \"popularity\": 26637\n  },\n  {\n    \"tag\": "synodsman",\n    \"popularity\": 26583\n  },\n  {\n    \"tag\": "placentalian",\n    \"popularity\": 26529\n  },\n  {\n    \"tag\": "corpulently",\n    \"popularity\": 26475\n  },\n  {\n    \"tag\": "photochromoscope",\n    \"popularity\": 26421\n  },\n  {\n    \"tag\": "indusiate retinasphaltum chokestrap",\n    \"popularity\": 26368\n  },\n  {\n    \"tag\": "murdrum",\n    \"popularity\": 26314\n  },\n  {\n    \"tag\": "belatedness",\n    \"popularity\": 26261\n  },\n  {\n    \"tag\": "Cochin",\n    \"popularity\": 26208\n  },\n  {\n    \"tag\": "Leonist",\n    \"popularity\": 26155\n  },\n  {\n    \"tag\": "keeker confined",\n    \"popularity\": 26102\n  },\n  {\n    \"tag\": "unintellectual",\n    \"popularity\": 26050\n  },\n  {\n    \"tag\": "nymphaline bait",\n    \"popularity\": 25997\n  },\n  {\n    \"tag\": "sarcosporidiosis",\n    \"popularity\": 25945\n  },\n  {\n    \"tag\": "catawamptiously",\n    \"popularity\": 25893\n  },\n  {\n    \"tag\": "outshame",\n    \"popularity\": 25841\n  },\n  {\n    \"tag\": "animalism",\n    \"popularity\": 25790\n  },\n  {\n    \"tag\": "epithalamial",\n    \"popularity\": 25738\n  },\n  {\n    \"tag\": "ganner",\n    \"popularity\": 25687\n  },\n  {\n    \"tag\": "desilicify",\n    \"popularity\": 25635\n  },\n  {\n    \"tag\": "dandyism",\n    \"popularity\": 25584\n  },\n  {\n    \"tag\": "hyleg",\n    \"popularity\": 25533\n  },\n  {\n    \"tag\": "photophysical",\n    \"popularity\": 25483\n  },\n  {\n    \"tag\": "underload",\n    \"popularity\": 25432\n  },\n  {\n    \"tag\": "unintrusive",\n    \"popularity\": 25382\n  },\n  {\n    \"tag\": "succinamic",\n    \"popularity\": 25331\n  },\n  {\n    \"tag\": "matchy",\n    \"popularity\": 25281\n  },\n  {\n    \"tag\": "concordal",\n    \"popularity\": 25231\n  },\n  {\n    \"tag\": "exteriority",\n    \"popularity\": 25181\n  },\n  {\n    \"tag\": "sterculiad",\n    \"popularity\": 25132\n  },\n  {\n    \"tag\": "sulfoxylic",\n    \"popularity\": 25082\n  },\n  {\n    \"tag\": "oversubscription",\n    \"popularity\": 25033\n  },\n  {\n    \"tag\": "chiasmic",\n    \"popularity\": 24984\n  },\n  {\n    \"tag\": "pseudoparthenogenesis",\n    \"popularity\": 24935\n  },\n  {\n    \"tag\": "indorse",\n    \"popularity\": 24886\n  },\n  {\n    \"tag\": "Krishnaite",\n    \"popularity\": 24837\n  },\n  {\n    \"tag\": "calcinize",\n    \"popularity\": 24788\n  },\n  {\n    \"tag\": "rhodium",\n    \"popularity\": 24740\n  },\n  {\n    \"tag\": "tragopan",\n    \"popularity\": 24692\n  },\n  {\n    \"tag\": "overwhelmingly",\n    \"popularity\": 24643\n  },\n  {\n    \"tag\": "procidence accorporate",\n    \"popularity\": 24595\n  },\n  {\n    \"tag\": "polemize speelless",\n    \"popularity\": 24548\n  },\n  {\n    \"tag\": "radiocarpal goran",\n    \"popularity\": 24500\n  },\n  {\n    \"tag\": "counteroffer Pelodytes",\n    \"popularity\": 24452\n  },\n  {\n    \"tag\": "lionhearted",\n    \"popularity\": 24405\n  },\n  {\n    \"tag\": "paramastoid",\n    \"popularity\": 24358\n  },\n  {\n    \"tag\": "murine",\n    \"popularity\": 24310\n  },\n  {\n    \"tag\": "woodbined",\n    \"popularity\": 24263\n  },\n  {\n    \"tag\": "packthread",\n    \"popularity\": 24217\n  },\n  {\n    \"tag\": "citreous",\n    \"popularity\": 24170\n  },\n  {\n    \"tag\": "unfallaciously",\n    \"popularity\": 24123\n  },\n  {\n    \"tag\": "tentwork reincarnadine",\n    \"popularity\": 24077\n  },\n  {\n    \"tag\": "verminousness",\n    \"popularity\": 24030\n  },\n  {\n    \"tag\": "sillometer",\n    \"popularity\": 23984\n  },\n  {\n    \"tag\": "jointy",\n    \"popularity\": 23938\n  },\n  {\n    \"tag\": "streptolysin",\n    \"popularity\": 23892\n  },\n  {\n    \"tag\": "Florentinism",\n    \"popularity\": 23847\n  },\n  {\n    \"tag\": "monosomatous",\n    \"popularity\": 23801\n  },\n  {\n    \"tag\": "capsulociliary",\n    \"popularity\": 23756\n  },\n  {\n    \"tag\": "organum",\n    \"popularity\": 23710\n  },\n  {\n    \"tag\": "overtly",\n    \"popularity\": 23665\n  },\n  {\n    \"tag\": "ophthalmoscopical",\n    \"popularity\": 23620\n  },\n  {\n    \"tag\": "supposititiously",\n    \"popularity\": 23575\n  },\n  {\n    \"tag\": "radiochemistry",\n    \"popularity\": 23530\n  },\n  {\n    \"tag\": "flaxtail",\n    \"popularity\": 23486\n  },\n  {\n    \"tag\": "pretympanic",\n    \"popularity\": 23441\n  },\n  {\n    \"tag\": "auscultation",\n    \"popularity\": 23397\n  },\n  {\n    \"tag\": "hairdresser",\n    \"popularity\": 23352\n  },\n  {\n    \"tag\": "chaffless",\n    \"popularity\": 23308\n  },\n  {\n    \"tag\": "polioencephalitis",\n    \"popularity\": 23264\n  },\n  {\n    \"tag\": "axolotl",\n    \"popularity\": 23220\n  },\n  {\n    \"tag\": "smous",\n    \"popularity\": 23177\n  },\n  {\n    \"tag\": "morgen disenamour toothed",\n    \"popularity\": 23133\n  },\n  {\n    \"tag\": "chaiseless",\n    \"popularity\": 23089\n  },\n  {\n    \"tag\": "frugally",\n    \"popularity\": 23046\n  },\n  {\n    \"tag\": "combustive antievolutionist cinenegative",\n    \"popularity\": 23003\n  },\n  {\n    \"tag\": "malacolite",\n    \"popularity\": 22960\n  },\n  {\n    \"tag\": "borne",\n    \"popularity\": 22917\n  },\n  {\n    \"tag\": "mercaptole",\n    \"popularity\": 22874\n  },\n  {\n    \"tag\": "judicatory",\n    \"popularity\": 22831\n  },\n  {\n    \"tag\": "noctivagation",\n    \"popularity\": 22789\n  },\n  {\n    \"tag\": "synthete",\n    \"popularity\": 22746\n  },\n  {\n    \"tag\": "tomboyism",\n    \"popularity\": 22704\n  },\n  {\n    \"tag\": "serranoid",\n    \"popularity\": 22661\n  },\n  {\n    \"tag\": "impostorism",\n    \"popularity\": 22619\n  },\n  {\n    \"tag\": "flagellosis Talitha",\n    \"popularity\": 22577\n  },\n  {\n    \"tag\": "pseudoviscous",\n    \"popularity\": 22535\n  },\n  {\n    \"tag\": "Galleriidae",\n    \"popularity\": 22494\n  },\n  {\n    \"tag\": "undulation didelph Comintern",\n    \"popularity\": 22452\n  },\n  {\n    \"tag\": "triangulopyramidal",\n    \"popularity\": 22411\n  },\n  {\n    \"tag\": "middlings",\n    \"popularity\": 22369\n  },\n  {\n    \"tag\": "piperazin",\n    \"popularity\": 22328\n  },\n  {\n    \"tag\": "endostitis",\n    \"popularity\": 22287\n  },\n  {\n    \"tag\": "swordlike",\n    \"popularity\": 22246\n  },\n  {\n    \"tag\": "forthwith",\n    \"popularity\": 22205\n  },\n  {\n    \"tag\": "menaceful",\n    \"popularity\": 22164\n  },\n  {\n    \"tag\": "explantation defective",\n    \"popularity\": 22123\n  },\n  {\n    \"tag\": "arrear",\n    \"popularity\": 22083\n  },\n  {\n    \"tag\": "engraft",\n    \"popularity\": 22042\n  },\n  {\n    \"tag\": "revolunteer",\n    \"popularity\": 22002\n  },\n  {\n    \"tag\": "foliaceous",\n    \"popularity\": 21962\n  },\n  {\n    \"tag\": "pseudograph",\n    \"popularity\": 21922\n  },\n  {\n    \"tag\": "maenaite",\n    \"popularity\": 21882\n  },\n  {\n    \"tag\": "interfinger",\n    \"popularity\": 21842\n  },\n  {\n    \"tag\": "macroscopically",\n    \"popularity\": 21802\n  },\n  {\n    \"tag\": "bluewood",\n    \"popularity\": 21762\n  },\n  {\n    \"tag\": "chikara",\n    \"popularity\": 21723\n  },\n  {\n    \"tag\": "reprehension diazeuxis nickelous",\n    \"popularity\": 21683\n  },\n  {\n    \"tag\": "vacuation",\n    \"popularity\": 21644\n  },\n  {\n    \"tag\": "Sartish",\n    \"popularity\": 21605\n  },\n  {\n    \"tag\": "pseudogyny",\n    \"popularity\": 21566\n  },\n  {\n    \"tag\": "friedcake",\n    \"popularity\": 21527\n  },\n  {\n    \"tag\": "thraw",\n    \"popularity\": 21488\n  },\n  {\n    \"tag\": "bifid",\n    \"popularity\": 21449\n  },\n  {\n    \"tag\": "truthlessly",\n    \"popularity\": 21411\n  },\n  {\n    \"tag\": "lungy",\n    \"popularity\": 21372\n  },\n  {\n    \"tag\": "fluoborite",\n    \"popularity\": 21334\n  },\n  {\n    \"tag\": "anthropolithic",\n    \"popularity\": 21295\n  },\n  {\n    \"tag\": "coachee straw",\n    \"popularity\": 21257\n  },\n  {\n    \"tag\": "dehorner Grecize",\n    \"popularity\": 21219\n  },\n  {\n    \"tag\": "spondylopyosis",\n    \"popularity\": 21181\n  },\n  {\n    \"tag\": "institutionary",\n    \"popularity\": 21143\n  },\n  {\n    \"tag\": "agentry",\n    \"popularity\": 21105\n  },\n  {\n    \"tag\": "musing bietle",\n    \"popularity\": 21068\n  },\n  {\n    \"tag\": "cormophyte",\n    \"popularity\": 21030\n  },\n  {\n    \"tag\": "semielliptic",\n    \"popularity\": 20993\n  },\n  {\n    \"tag\": "ependytes",\n    \"popularity\": 20955\n  },\n  {\n    \"tag\": "coachmaster",\n    \"popularity\": 20918\n  },\n  {\n    \"tag\": "overexuberant",\n    \"popularity\": 20881\n  },\n  {\n    \"tag\": "selectable",\n    \"popularity\": 20844\n  },\n  {\n    \"tag\": "saclike",\n    \"popularity\": 20807\n  },\n  {\n    \"tag\": "mullion",\n    \"popularity\": 20770\n  },\n  {\n    \"tag\": "pantheonize prevalency",\n    \"popularity\": 20733\n  },\n  {\n    \"tag\": "trophosperm",\n    \"popularity\": 20697\n  },\n  {\n    \"tag\": "paraphrasist",\n    \"popularity\": 20660\n  },\n  {\n    \"tag\": "undercarry",\n    \"popularity\": 20624\n  },\n  {\n    \"tag\": "thallogenic",\n    \"popularity\": 20587\n  },\n  {\n    \"tag\": "bulgy forbid",\n    \"popularity\": 20551\n  },\n  {\n    \"tag\": "proliquor gratulatory",\n    \"popularity\": 20515\n  },\n  {\n    \"tag\": "booker",\n    \"popularity\": 20479\n  },\n  {\n    \"tag\": "wizen",\n    \"popularity\": 20443\n  },\n  {\n    \"tag\": "synchondrosially",\n    \"popularity\": 20407\n  },\n  {\n    \"tag\": "herbless",\n    \"popularity\": 20371\n  },\n  {\n    \"tag\": "arfvedsonite",\n    \"popularity\": 20336\n  },\n  {\n    \"tag\": "Neuroptera",\n    \"popularity\": 20300\n  },\n  {\n    \"tag\": "fingerstone",\n    \"popularity\": 20265\n  },\n  {\n    \"tag\": "Odontoglossae",\n    \"popularity\": 20229\n  },\n  {\n    \"tag\": "transmigrator",\n    \"popularity\": 20194\n  },\n  {\n    \"tag\": "Dehaites",\n    \"popularity\": 20159\n  },\n  {\n    \"tag\": "Molinist",\n    \"popularity\": 20124\n  },\n  {\n    \"tag\": "novelistic",\n    \"popularity\": 20089\n  },\n  {\n    \"tag\": "astelic",\n    \"popularity\": 20054\n  },\n  {\n    \"tag\": "pyelometry",\n    \"popularity\": 20019\n  },\n  {\n    \"tag\": "pigmentation",\n    \"popularity\": 19984\n  },\n  {\n    \"tag\": "epinaos",\n    \"popularity\": 19950\n  },\n  {\n    \"tag\": "outdare",\n    \"popularity\": 19915\n  },\n  {\n    \"tag\": "Funje philaristocracy",\n    \"popularity\": 19881\n  },\n  {\n    \"tag\": "keddah",\n    \"popularity\": 19846\n  },\n  {\n    \"tag\": "axoidean",\n    \"popularity\": 19812\n  },\n  {\n    \"tag\": "ovule",\n    \"popularity\": 19778\n  },\n  {\n    \"tag\": "solidify",\n    \"popularity\": 19744\n  },\n  {\n    \"tag\": "noncelestial",\n    \"popularity\": 19710\n  },\n  {\n    \"tag\": "overmultiplication",\n    \"popularity\": 19676\n  },\n  {\n    \"tag\": "hexatetrahedron",\n    \"popularity\": 19642\n  },\n  {\n    \"tag\": "pliciform",\n    \"popularity\": 19609\n  },\n  {\n    \"tag\": "zimbalon",\n    \"popularity\": 19575\n  },\n  {\n    \"tag\": "annexational",\n    \"popularity\": 19542\n  },\n  {\n    \"tag\": "eurhodol",\n    \"popularity\": 19508\n  },\n  {\n    \"tag\": "yark",\n    \"popularity\": 19475\n  },\n  {\n    \"tag\": "illegality nitroalizarin",\n    \"popularity\": 19442\n  },\n  {\n    \"tag\": "quadratum",\n    \"popularity\": 19409\n  },\n  {\n    \"tag\": "saccharine",\n    \"popularity\": 19376\n  },\n  {\n    \"tag\": "unemploy",\n    \"popularity\": 19343\n  },\n  {\n    \"tag\": "uniclinal unipotent",\n    \"popularity\": 19310\n  },\n  {\n    \"tag\": "turbo",\n    \"popularity\": 19277\n  },\n  {\n    \"tag\": "sybarism",\n    \"popularity\": 19244\n  },\n  {\n    \"tag\": "motacilline",\n    \"popularity\": 19212\n  },\n  {\n    \"tag\": "weaselly",\n    \"popularity\": 19179\n  },\n  {\n    \"tag\": "plastid",\n    \"popularity\": 19147\n  },\n  {\n    \"tag\": "wasting",\n    \"popularity\": 19114\n  },\n  {\n    \"tag\": "begrime fluting",\n    \"popularity\": 19082\n  },\n  {\n    \"tag\": "Nephilinae",\n    \"popularity\": 19050\n  },\n  {\n    \"tag\": "disregardance",\n    \"popularity\": 19018\n  },\n  {\n    \"tag\": "Shakerlike",\n    \"popularity\": 18986\n  },\n  {\n    \"tag\": "uniped",\n    \"popularity\": 18954\n  },\n  {\n    \"tag\": "knap",\n    \"popularity\": 18922\n  },\n  {\n    \"tag\": "electivism undergardener",\n    \"popularity\": 18890\n  },\n  {\n    \"tag\": "hulverheaded",\n    \"popularity\": 18858\n  },\n  {\n    \"tag\": "unruptured",\n    \"popularity\": 18827\n  },\n  {\n    \"tag\": "solemnize credently",\n    \"popularity\": 18795\n  },\n  {\n    \"tag\": "pentastomoid possessingly",\n    \"popularity\": 18764\n  },\n  {\n    \"tag\": "octose",\n    \"popularity\": 18733\n  },\n  {\n    \"tag\": "psithurism indefensibility",\n    \"popularity\": 18701\n  },\n  {\n    \"tag\": "torrentuous cyanometer subcrenate",\n    \"popularity\": 18670\n  },\n  {\n    \"tag\": "photoplaywright tapaculo",\n    \"popularity\": 18639\n  },\n  {\n    \"tag\": "univalence",\n    \"popularity\": 18608\n  },\n  {\n    \"tag\": "Porthetria",\n    \"popularity\": 18577\n  },\n  {\n    \"tag\": "funambulo",\n    \"popularity\": 18546\n  },\n  {\n    \"tag\": "pedion",\n    \"popularity\": 18515\n  },\n  {\n    \"tag\": "horticulturally",\n    \"popularity\": 18485\n  },\n  {\n    \"tag\": "marennin",\n    \"popularity\": 18454\n  },\n  {\n    \"tag\": "horselaugh",\n    \"popularity\": 18423\n  },\n  {\n    \"tag\": "semiexecutive",\n    \"popularity\": 18393\n  },\n  {\n    \"tag\": "Monopteridae",\n    \"popularity\": 18363\n  },\n  {\n    \"tag\": "commonable",\n    \"popularity\": 18332\n  },\n  {\n    \"tag\": "dreariment",\n    \"popularity\": 18302\n  },\n  {\n    \"tag\": "disbud",\n    \"popularity\": 18272\n  },\n  {\n    \"tag\": "monocled",\n    \"popularity\": 18242\n  },\n  {\n    \"tag\": "hurlbarrow",\n    \"popularity\": 18212\n  },\n  {\n    \"tag\": "opiateproof",\n    \"popularity\": 18182\n  },\n  {\n    \"tag\": "Fahrenheit",\n    \"popularity\": 18152\n  },\n  {\n    \"tag\": "writhed",\n    \"popularity\": 18122\n  },\n  {\n    \"tag\": "Volstead",\n    \"popularity\": 18093\n  },\n  {\n    \"tag\": "yesternight",\n    \"popularity\": 18063\n  },\n  {\n    \"tag\": "readmittance",\n    \"popularity\": 18033\n  },\n  {\n    \"tag\": "reiterable",\n    \"popularity\": 18004\n  },\n  {\n    \"tag\": "triquetral",\n    \"popularity\": 17975\n  },\n  {\n    \"tag\": "guillotinement",\n    \"popularity\": 17945\n  },\n  {\n    \"tag\": "repermission",\n    \"popularity\": 17916\n  },\n  {\n    \"tag\": "assishly",\n    \"popularity\": 17887\n  },\n  {\n    \"tag\": "daidle",\n    \"popularity\": 17858\n  },\n  {\n    \"tag\": "prismatoid",\n    \"popularity\": 17829\n  },\n  {\n    \"tag\": "irreptitious",\n    \"popularity\": 17800\n  },\n  {\n    \"tag\": "sourdeline",\n    \"popularity\": 17771\n  },\n  {\n    \"tag\": "Austrian",\n    \"popularity\": 17742\n  },\n  {\n    \"tag\": "psychorrhagic",\n    \"popularity\": 17713\n  },\n  {\n    \"tag\": "Monumbo",\n    \"popularity\": 17685\n  },\n  {\n    \"tag\": "cloiochoanitic",\n    \"popularity\": 17656\n  },\n  {\n    \"tag\": "hant",\n    \"popularity\": 17628\n  },\n  {\n    \"tag\": "roily pulldown",\n    \"popularity\": 17599\n  },\n  {\n    \"tag\": "recongratulation",\n    \"popularity\": 17571\n  },\n  {\n    \"tag\": "Peking",\n    \"popularity\": 17543\n  },\n  {\n    \"tag\": "erdvark",\n    \"popularity\": 17514\n  },\n  {\n    \"tag\": "antimnemonic",\n    \"popularity\": 17486\n  },\n  {\n    \"tag\": "noncapillarity",\n    \"popularity\": 17458\n  },\n  {\n    \"tag\": "irrepressive",\n    \"popularity\": 17430\n  },\n  {\n    \"tag\": "Petromyzontes",\n    \"popularity\": 17402\n  },\n  {\n    \"tag\": "piscatorially",\n    \"popularity\": 17374\n  },\n  {\n    \"tag\": "cholesterosis",\n    \"popularity\": 17346\n  },\n  {\n    \"tag\": "denunciate",\n    \"popularity\": 17319\n  },\n  {\n    \"tag\": "unmetalled",\n    \"popularity\": 17291\n  },\n  {\n    \"tag\": "Tigris enruin",\n    \"popularity\": 17263\n  },\n  {\n    \"tag\": "anaspalin",\n    \"popularity\": 17236\n  },\n  {\n    \"tag\": "monodromy",\n    \"popularity\": 17208\n  },\n  {\n    \"tag\": "Canichanan",\n    \"popularity\": 17181\n  },\n  {\n    \"tag\": "mesolabe",\n    \"popularity\": 17154\n  },\n  {\n    \"tag\": "trichothallic overcunningness",\n    \"popularity\": 17127\n  },\n  {\n    \"tag\": "spinsterishly",\n    \"popularity\": 17099\n  },\n  {\n    \"tag\": "sensilla",\n    \"popularity\": 17072\n  },\n  {\n    \"tag\": "wifelkin",\n    \"popularity\": 17045\n  },\n  {\n    \"tag\": "suppositionless",\n    \"popularity\": 17018\n  },\n  {\n    \"tag\": "irksomeness",\n    \"popularity\": 16991\n  },\n  {\n    \"tag\": "sanbenito",\n    \"popularity\": 16964\n  },\n  {\n    \"tag\": "nonstatement",\n    \"popularity\": 16938\n  },\n  {\n    \"tag\": "phenoloid",\n    \"popularity\": 16911\n  },\n  {\n    \"tag\": "Steinberger",\n    \"popularity\": 16884\n  },\n  {\n    \"tag\": "replicated boom",\n    \"popularity\": 16858\n  },\n  {\n    \"tag\": "sciomachiology",\n    \"popularity\": 16831\n  },\n  {\n    \"tag\": "starwise",\n    \"popularity\": 16805\n  },\n  {\n    \"tag\": "prerich",\n    \"popularity\": 16778\n  },\n  {\n    \"tag\": "unspawned",\n    \"popularity\": 16752\n  },\n  {\n    \"tag\": "unindentable",\n    \"popularity\": 16726\n  },\n  {\n    \"tag\": "stromatic",\n    \"popularity\": 16700\n  },\n  {\n    \"tag\": "fetishize",\n    \"popularity\": 16673\n  },\n  {\n    \"tag\": "dihydroxy",\n    \"popularity\": 16647\n  },\n  {\n    \"tag\": "precaudal",\n    \"popularity\": 16621\n  },\n  {\n    \"tag\": "Madagascar",\n    \"popularity\": 16595\n  },\n  {\n    \"tag\": "repinement",\n    \"popularity\": 16570\n  },\n  {\n    \"tag\": "noncathedral wenzel",\n    \"popularity\": 16544\n  },\n  {\n    \"tag\": "corollike",\n    \"popularity\": 16518\n  },\n  {\n    \"tag\": "pubes unamortization",\n    \"popularity\": 16492\n  },\n  {\n    \"tag\": "brickcroft",\n    \"popularity\": 16467\n  },\n  {\n    \"tag\": "intertrabecular",\n    \"popularity\": 16441\n  },\n  {\n    \"tag\": "formulaic",\n    \"popularity\": 16416\n  },\n  {\n    \"tag\": "arienzo",\n    \"popularity\": 16390\n  },\n  {\n    \"tag\": "Mazzinian",\n    \"popularity\": 16365\n  },\n  {\n    \"tag\": "wallowishly",\n    \"popularity\": 16339\n  },\n  {\n    \"tag\": "sysselman",\n    \"popularity\": 16314\n  },\n  {\n    \"tag\": "seligmannite",\n    \"popularity\": 16289\n  },\n  {\n    \"tag\": "harlequinery",\n    \"popularity\": 16264\n  },\n  {\n    \"tag\": "zucchetto",\n    \"popularity\": 16239\n  },\n  {\n    \"tag\": "malonyl",\n    \"popularity\": 16214\n  },\n  {\n    \"tag\": "patwari",\n    \"popularity\": 16189\n  },\n  {\n    \"tag\": "neoholmia venturesomeness",\n    \"popularity\": 16164\n  },\n  {\n    \"tag\": "Dehwar",\n    \"popularity\": 16139\n  },\n  {\n    \"tag\": "fetiferous",\n    \"popularity\": 16114\n  },\n  {\n    \"tag\": "chromatophore",\n    \"popularity\": 16090\n  },\n  {\n    \"tag\": "reregistration",\n    \"popularity\": 16065\n  },\n  {\n    \"tag\": "alienor",\n    \"popularity\": 16040\n  },\n  {\n    \"tag\": "Hexagynia",\n    \"popularity\": 16016\n  },\n  {\n    \"tag\": "cerebrotonia",\n    \"popularity\": 15991\n  },\n  {\n    \"tag\": "deedbox",\n    \"popularity\": 15967\n  },\n  {\n    \"tag\": "staab",\n    \"popularity\": 15943\n  },\n  {\n    \"tag\": "uratemia",\n    \"popularity\": 15918\n  },\n  {\n    \"tag\": "flaunt",\n    \"popularity\": 15894\n  },\n  {\n    \"tag\": "bogy",\n    \"popularity\": 15870\n  },\n  {\n    \"tag\": "subcartilaginous",\n    \"popularity\": 15846\n  },\n  {\n    \"tag\": "protonephridial",\n    \"popularity\": 15822\n  },\n  {\n    \"tag\": "Boswellia",\n    \"popularity\": 15798\n  },\n  {\n    \"tag\": "relaxant untiaraed protoepiphyte",\n    \"popularity\": 15774\n  },\n  {\n    \"tag\": "nesslerization",\n    \"popularity\": 15750\n  },\n  {\n    \"tag\": "precession",\n    \"popularity\": 15726\n  },\n  {\n    \"tag\": "peat",\n    \"popularity\": 15702\n  },\n  {\n    \"tag\": "unbit",\n    \"popularity\": 15678\n  },\n  {\n    \"tag\": "snailish",\n    \"popularity\": 15655\n  },\n  {\n    \"tag\": "porismatical",\n    \"popularity\": 15631\n  },\n  {\n    \"tag\": "hooflike",\n    \"popularity\": 15608\n  },\n  {\n    \"tag\": "resuppose phene cranic",\n    \"popularity\": 15584\n  },\n  {\n    \"tag\": "peptonization kipskin",\n    \"popularity\": 15561\n  },\n  {\n    \"tag\": "birdstone",\n    \"popularity\": 15537\n  },\n  {\n    \"tag\": "empty inferoanterior",\n    \"popularity\": 15514\n  },\n  {\n    \"tag\": "androtauric",\n    \"popularity\": 15491\n  },\n  {\n    \"tag\": "triamide",\n    \"popularity\": 15467\n  },\n  {\n    \"tag\": "showmanry",\n    \"popularity\": 15444\n  },\n  {\n    \"tag\": "doing",\n    \"popularity\": 15421\n  },\n  {\n    \"tag\": "bouchaleen",\n    \"popularity\": 15398\n  },\n  {\n    \"tag\": "precollude",\n    \"popularity\": 15375\n  },\n  {\n    \"tag\": "finger",\n    \"popularity\": 15352\n  },\n  {\n    \"tag\": "limnetic intermessenger",\n    \"popularity\": 15329\n  },\n  {\n    \"tag\": "uncharitable picrotoxic",\n    \"popularity\": 15306\n  },\n  {\n    \"tag\": "nationalizer Phasmidae",\n    \"popularity\": 15283\n  },\n  {\n    \"tag\": "laughingstock",\n    \"popularity\": 15261\n  },\n  {\n    \"tag\": "nondeferential",\n    \"popularity\": 15238\n  },\n  {\n    \"tag\": "uproariously",\n    \"popularity\": 15215\n  },\n  {\n    \"tag\": "manzanilla",\n    \"popularity\": 15193\n  },\n  {\n    \"tag\": "khahoon",\n    \"popularity\": 15170\n  },\n  {\n    \"tag\": "olericulturally longshanks",\n    \"popularity\": 15148\n  },\n  {\n    \"tag\": "enthusiastically methionic",\n    \"popularity\": 15125\n  },\n  {\n    \"tag\": "pobs",\n    \"popularity\": 15103\n  },\n  {\n    \"tag\": "tricarpellate",\n    \"popularity\": 15081\n  },\n  {\n    \"tag\": "souterrain",\n    \"popularity\": 15058\n  },\n  {\n    \"tag\": "tethelin",\n    \"popularity\": 15036\n  },\n  {\n    \"tag\": "tartle",\n    \"popularity\": 15014\n  },\n  {\n    \"tag\": "tidelike",\n    \"popularity\": 14992\n  },\n  {\n    \"tag\": "cosmoramic",\n    \"popularity\": 14970\n  },\n  {\n    \"tag\": "pretardiness",\n    \"popularity\": 14948\n  },\n  {\n    \"tag\": "insoul",\n    \"popularity\": 14926\n  },\n  {\n    \"tag\": "anthroxan",\n    \"popularity\": 14904\n  },\n  {\n    \"tag\": "jilter",\n    \"popularity\": 14882\n  },\n  {\n    \"tag\": "pectinibranchian trematode",\n    \"popularity\": 14860\n  },\n  {\n    \"tag\": "Renaissancist",\n    \"popularity\": 14838\n  },\n  {\n    \"tag\": "imaginant",\n    \"popularity\": 14817\n  },\n  {\n    \"tag\": "supercensure",\n    \"popularity\": 14795\n  },\n  {\n    \"tag\": "festilogy",\n    \"popularity\": 14773\n  },\n  {\n    \"tag\": "regression",\n    \"popularity\": 14752\n  },\n  {\n    \"tag\": "mesobregmate languorously",\n    \"popularity\": 14730\n  },\n  {\n    \"tag\": "unsupernaturalized",\n    \"popularity\": 14709\n  },\n  {\n    \"tag\": "boobyish",\n    \"popularity\": 14687\n  },\n  {\n    \"tag\": "scopolamine",\n    \"popularity\": 14666\n  },\n  {\n    \"tag\": "reamputation unchristianly",\n    \"popularity\": 14645\n  },\n  {\n    \"tag\": "cuneatic",\n    \"popularity\": 14623\n  },\n  {\n    \"tag\": "heathberry",\n    \"popularity\": 14602\n  },\n  {\n    \"tag\": "hate",\n    \"popularity\": 14581\n  },\n  {\n    \"tag\": "redeemableness",\n    \"popularity\": 14560\n  },\n  {\n    \"tag\": "damasse",\n    \"popularity\": 14539\n  },\n  {\n    \"tag\": "thrillsome",\n    \"popularity\": 14518\n  },\n  {\n    \"tag\": "disseverment",\n    \"popularity\": 14497\n  },\n  {\n    \"tag\": "underbishopric Ostyak",\n    \"popularity\": 14476\n  },\n  {\n    \"tag\": "Exoascales",\n    \"popularity\": 14455\n  },\n  {\n    \"tag\": "soiled",\n    \"popularity\": 14434\n  },\n  {\n    \"tag\": "Cain",\n    \"popularity\": 14413\n  },\n  {\n    \"tag\": "mismanageable arenae",\n    \"popularity\": 14392\n  },\n  {\n    \"tag\": "manducate unhinderably",\n    \"popularity\": 14372\n  },\n  {\n    \"tag\": "peregrin",\n    \"popularity\": 14351\n  },\n  {\n    \"tag\": "musicianly",\n    \"popularity\": 14330\n  },\n  {\n    \"tag\": "aln",\n    \"popularity\": 14310\n  },\n  {\n    \"tag\": "intercentrum",\n    \"popularity\": 14289\n  },\n  {\n    \"tag\": "roothold",\n    \"popularity\": 14269\n  },\n  {\n    \"tag\": "jane aneurism",\n    \"popularity\": 14248\n  },\n  {\n    \"tag\": "insinuatively forefeel phytolatrous",\n    \"popularity\": 14228\n  },\n  {\n    \"tag\": "kanchil",\n    \"popularity\": 14208\n  },\n  {\n    \"tag\": "Austrophile",\n    \"popularity\": 14187\n  },\n  {\n    \"tag\": "unterrorized",\n    \"popularity\": 14167\n  },\n  {\n    \"tag\": "admeasure",\n    \"popularity\": 14147\n  },\n  {\n    \"tag\": "electrodissolution",\n    \"popularity\": 14127\n  },\n  {\n    \"tag\": "unweddedly",\n    \"popularity\": 14107\n  },\n  {\n    \"tag\": "unannoying",\n    \"popularity\": 14087\n  },\n  {\n    \"tag\": "uningenuous",\n    \"popularity\": 14067\n  },\n  {\n    \"tag\": "omnibenevolent",\n    \"popularity\": 14047\n  },\n  {\n    \"tag\": "commissure",\n    \"popularity\": 14027\n  },\n  {\n    \"tag\": "tellureted",\n    \"popularity\": 14007\n  },\n  {\n    \"tag\": "suffragan",\n    \"popularity\": 13987\n  },\n  {\n    \"tag\": "sphaeriaceous",\n    \"popularity\": 13967\n  },\n  {\n    \"tag\": "unfearing",\n    \"popularity\": 13947\n  },\n  {\n    \"tag\": "stentoriousness precounsellor",\n    \"popularity\": 13928\n  },\n  {\n    \"tag\": "haemaspectroscope",\n    \"popularity\": 13908\n  },\n  {\n    \"tag\": "teras",\n    \"popularity\": 13888\n  },\n  {\n    \"tag\": "pulicine",\n    \"popularity\": 13869\n  },\n  {\n    \"tag\": "colicystopyelitis",\n    \"popularity\": 13849\n  },\n  {\n    \"tag\": "Physalia",\n    \"popularity\": 13830\n  },\n  {\n    \"tag\": "Saxicolidae",\n    \"popularity\": 13810\n  },\n  {\n    \"tag\": "peritonital",\n    \"popularity\": 13791\n  },\n  {\n    \"tag\": "dysphotic",\n    \"popularity\": 13771\n  },\n  {\n    \"tag\": "unabandoned",\n    \"popularity\": 13752\n  },\n  {\n    \"tag\": "rashful",\n    \"popularity\": 13733\n  },\n  {\n    \"tag\": "goodyness Manobo",\n    \"popularity\": 13714\n  },\n  {\n    \"tag\": "glaring",\n    \"popularity\": 13694\n  },\n  {\n    \"tag\": "horrorful",\n    \"popularity\": 13675\n  },\n  {\n    \"tag\": "intercepting",\n    \"popularity\": 13656\n  },\n  {\n    \"tag\": "semifine",\n    \"popularity\": 13637\n  },\n  {\n    \"tag\": "Gaypoo",\n    \"popularity\": 13618\n  },\n  {\n    \"tag\": "Metrosideros",\n    \"popularity\": 13599\n  },\n  {\n    \"tag\": "thoracicolumbar",\n    \"popularity\": 13580\n  },\n  {\n    \"tag\": "unserried",\n    \"popularity\": 13561\n  },\n  {\n    \"tag\": "keeperess cauterization",\n    \"popularity\": 13542\n  },\n  {\n    \"tag\": "administrant",\n    \"popularity\": 13523\n  },\n  {\n    \"tag\": "unpropitiatedness",\n    \"popularity\": 13505\n  },\n  {\n    \"tag\": "pensileness",\n    \"popularity\": 13486\n  },\n  {\n    \"tag\": "quinaldic unreceivable",\n    \"popularity\": 13467\n  },\n  {\n    \"tag\": "Carnaria",\n    \"popularity\": 13448\n  },\n  {\n    \"tag\": "azothionium wurrus",\n    \"popularity\": 13430\n  },\n  {\n    \"tag\": "mistresshood",\n    \"popularity\": 13411\n  },\n  {\n    \"tag\": "Savara",\n    \"popularity\": 13393\n  },\n  {\n    \"tag\": "dasyurine",\n    \"popularity\": 13374\n  },\n  {\n    \"tag\": "superideal",\n    \"popularity\": 13356\n  },\n  {\n    \"tag\": "Parisianize",\n    \"popularity\": 13337\n  },\n  {\n    \"tag\": "underearth",\n    \"popularity\": 13319\n  },\n  {\n    \"tag\": "athrogenic",\n    \"popularity\": 13301\n  },\n  {\n    \"tag\": "communicate",\n    \"popularity\": 13282\n  },\n  {\n    \"tag\": "denervation enworthed",\n    \"popularity\": 13264\n  },\n  {\n    \"tag\": "subbromide",\n    \"popularity\": 13246\n  },\n  {\n    \"tag\": "stenocoriasis",\n    \"popularity\": 13228\n  },\n  {\n    \"tag\": "facetiousness",\n    \"popularity\": 13209\n  },\n  {\n    \"tag\": "twaddling",\n    \"popularity\": 13191\n  },\n  {\n    \"tag\": "tetartoconid",\n    \"popularity\": 13173\n  },\n  {\n    \"tag\": "audiophile",\n    \"popularity\": 13155\n  },\n  {\n    \"tag\": "fustigate",\n    \"popularity\": 13137\n  },\n  {\n    \"tag\": "Sorbian cacophonia",\n    \"popularity\": 13119\n  },\n  {\n    \"tag\": "fondish",\n    \"popularity\": 13101\n  },\n  {\n    \"tag\": "endomastoiditis",\n    \"popularity\": 13084\n  },\n  {\n    \"tag\": "sniptious",\n    \"popularity\": 13066\n  },\n  {\n    \"tag\": "glochidiate",\n    \"popularity\": 13048\n  },\n  {\n    \"tag\": "polycarboxylic",\n    \"popularity\": 13030\n  },\n  {\n    \"tag\": "stamp",\n    \"popularity\": 13012\n  },\n  {\n    \"tag\": "tritonymph endotoxoid",\n    \"popularity\": 12995\n  },\n  {\n    \"tag\": "wolfskin",\n    \"popularity\": 12977\n  },\n  {\n    \"tag\": "oncosimeter",\n    \"popularity\": 12959\n  },\n  {\n    \"tag\": "outward",\n    \"popularity\": 12942\n  },\n  {\n    \"tag\": "circumscribed",\n    \"popularity\": 12924\n  },\n  {\n    \"tag\": "autohemolytic",\n    \"popularity\": 12907\n  },\n  {\n    \"tag\": "isorhamnose",\n    \"popularity\": 12889\n  },\n  {\n    \"tag\": "monarchomachic",\n    \"popularity\": 12872\n  },\n  {\n    \"tag\": "phaenomenon",\n    \"popularity\": 12855\n  },\n  {\n    \"tag\": "angiopressure",\n    \"popularity\": 12837\n  },\n  {\n    \"tag\": "similarize",\n    \"popularity\": 12820\n  },\n  {\n    \"tag\": "unseeable",\n    \"popularity\": 12803\n  },\n  {\n    \"tag\": "Toryize",\n    \"popularity\": 12785\n  },\n  {\n    \"tag\": "fruitling",\n    \"popularity\": 12768\n  },\n  {\n    \"tag\": "axle",\n    \"popularity\": 12751\n  },\n  {\n    \"tag\": "priestal cocked",\n    \"popularity\": 12734\n  },\n  {\n    \"tag\": "serotoxin",\n    \"popularity\": 12717\n  },\n  {\n    \"tag\": "unmovably",\n    \"popularity\": 12700\n  },\n  {\n    \"tag\": "darbha",\n    \"popularity\": 12683\n  },\n  {\n    \"tag\": "Mongolize",\n    \"popularity\": 12666\n  },\n  {\n    \"tag\": "clusteringly",\n    \"popularity\": 12649\n  },\n  {\n    \"tag\": "tendence",\n    \"popularity\": 12632\n  },\n  {\n    \"tag\": "foziness",\n    \"popularity\": 12615\n  },\n  {\n    \"tag\": "brickkiln lithify",\n    \"popularity\": 12598\n  },\n  {\n    \"tag\": "unpriest",\n    \"popularity\": 12581\n  },\n  {\n    \"tag\": "convincer",\n    \"popularity\": 12564\n  },\n  {\n    \"tag\": "mornlike",\n    \"popularity\": 12548\n  },\n  {\n    \"tag\": "overaddiction ostentatiousness",\n    \"popularity\": 12531\n  },\n  {\n    \"tag\": "diffusively moccasin pendom",\n    \"popularity\": 12514\n  },\n  {\n    \"tag\": "boose",\n    \"popularity\": 12498\n  },\n  {\n    \"tag\": "myonosus",\n    \"popularity\": 12481\n  },\n  {\n    \"tag\": "handsome",\n    \"popularity\": 12464\n  },\n  {\n    \"tag\": "paroxysmic",\n    \"popularity\": 12448\n  },\n  {\n    \"tag\": "Ulidian",\n    \"popularity\": 12431\n  },\n  {\n    \"tag\": "heartache",\n    \"popularity\": 12415\n  },\n  {\n    \"tag\": "torporize",\n    \"popularity\": 12398\n  },\n  {\n    \"tag\": "hippish",\n    \"popularity\": 12382\n  },\n  {\n    \"tag\": "stigmal militation",\n    \"popularity\": 12366\n  },\n  {\n    \"tag\": "matmaker",\n    \"popularity\": 12349\n  },\n  {\n    \"tag\": "marantaceous bivoluminous",\n    \"popularity\": 12333\n  },\n  {\n    \"tag\": "Uraniidae",\n    \"popularity\": 12317\n  },\n  {\n    \"tag\": "risper",\n    \"popularity\": 12301\n  },\n  {\n    \"tag\": "tintinnabulation",\n    \"popularity\": 12284\n  },\n  {\n    \"tag\": "tributorian",\n    \"popularity\": 12268\n  },\n  {\n    \"tag\": "ashamedly",\n    \"popularity\": 12252\n  },\n  {\n    \"tag\": "Macrourus",\n    \"popularity\": 12236\n  },\n  {\n    \"tag\": "Chora",\n    \"popularity\": 12220\n  },\n  {\n    \"tag\": "caul",\n    \"popularity\": 12204\n  },\n  {\n    \"tag\": "exsector",\n    \"popularity\": 12188\n  },\n  {\n    \"tag\": "acutish",\n    \"popularity\": 12172\n  },\n  {\n    \"tag\": "amphichrome",\n    \"popularity\": 12156\n  },\n  {\n    \"tag\": "guarder",\n    \"popularity\": 12140\n  },\n  {\n    \"tag\": "sculpturally",\n    \"popularity\": 12124\n  },\n  {\n    \"tag\": "benightmare",\n    \"popularity\": 12108\n  },\n  {\n    \"tag\": "chucky",\n    \"popularity\": 12093\n  },\n  {\n    \"tag\": "Venetian",\n    \"popularity\": 12077\n  },\n  {\n    \"tag\": "autotheater",\n    \"popularity\": 12061\n  },\n  {\n    \"tag\": "planarioid",\n    \"popularity\": 12045\n  },\n  {\n    \"tag\": "handkerchiefful",\n    \"popularity\": 12030\n  },\n  {\n    \"tag\": "fuliginousness potentize",\n    \"popularity\": 12014\n  },\n  {\n    \"tag\": "pantheum",\n    \"popularity\": 11998\n  },\n  {\n    \"tag\": "heavyweight",\n    \"popularity\": 11983\n  },\n  {\n    \"tag\": "unbrick",\n    \"popularity\": 11967\n  },\n  {\n    \"tag\": "duomachy",\n    \"popularity\": 11952\n  },\n  {\n    \"tag\": "polyphyodont",\n    \"popularity\": 11936\n  },\n  {\n    \"tag\": "hibernacle",\n    \"popularity\": 11921\n  },\n  {\n    \"tag\": "undistend",\n    \"popularity\": 11905\n  },\n  {\n    \"tag\": "hystericky",\n    \"popularity\": 11890\n  },\n  {\n    \"tag\": "paleolimnology",\n    \"popularity\": 11875\n  },\n  {\n    \"tag\": "cedarware",\n    \"popularity\": 11859\n  },\n  {\n    \"tag\": "overwrested",\n    \"popularity\": 11844\n  },\n  {\n    \"tag\": "Syriacism",\n    \"popularity\": 11829\n  },\n  {\n    \"tag\": "pretan",\n    \"popularity\": 11813\n  },\n  {\n    \"tag\": "formant",\n    \"popularity\": 11798\n  },\n  {\n    \"tag\": "pharmacopoeist Fedia",\n    \"popularity\": 11783\n  },\n  {\n    \"tag\": "exorcist eerisome",\n    \"popularity\": 11768\n  },\n  {\n    \"tag\": "separation",\n    \"popularity\": 11753\n  },\n  {\n    \"tag\": "infancy",\n    \"popularity\": 11738\n  },\n  {\n    \"tag\": "ecrasite",\n    \"popularity\": 11723\n  },\n  {\n    \"tag\": "propolize",\n    \"popularity\": 11708\n  },\n  {\n    \"tag\": "uncram phyllin",\n    \"popularity\": 11693\n  },\n  {\n    \"tag\": "thymopathy",\n    \"popularity\": 11678\n  },\n  {\n    \"tag\": "omniscient",\n    \"popularity\": 11663\n  },\n  {\n    \"tag\": "coussinet hazer",\n    \"popularity\": 11648\n  },\n  {\n    \"tag\": "contributiveness",\n    \"popularity\": 11633\n  },\n  {\n    \"tag\": "septifluous",\n    \"popularity\": 11618\n  },\n  {\n    \"tag\": "halfness",\n    \"popularity\": 11603\n  },\n  {\n    \"tag\": "tocher",\n    \"popularity\": 11589\n  },\n  {\n    \"tag\": "monotonist",\n    \"popularity\": 11574\n  },\n  {\n    \"tag\": "headchair",\n    \"popularity\": 11559\n  },\n  {\n    \"tag\": "everywhence",\n    \"popularity\": 11544\n  },\n  {\n    \"tag\": "gerate",\n    \"popularity\": 11530\n  },\n  {\n    \"tag\": "unrepellent",\n    \"popularity\": 11515\n  },\n  {\n    \"tag\": "inidoneous",\n    \"popularity\": 11500\n  },\n  {\n    \"tag\": "Rifi",\n    \"popularity\": 11486\n  },\n  {\n    \"tag\": "unstop",\n    \"popularity\": 11471\n  },\n  {\n    \"tag\": "conformer",\n    \"popularity\": 11457\n  },\n  {\n    \"tag\": "vivisectionally",\n    \"popularity\": 11442\n  },\n  {\n    \"tag\": "nonfinishing",\n    \"popularity\": 11428\n  },\n  {\n    \"tag\": "tyranness",\n    \"popularity\": 11413\n  },\n  {\n    \"tag\": "shepherdage havoc",\n    \"popularity\": 11399\n  },\n  {\n    \"tag\": "coronale",\n    \"popularity\": 11385\n  },\n  {\n    \"tag\": "airmarker",\n    \"popularity\": 11370\n  },\n  {\n    \"tag\": "subpanel",\n    \"popularity\": 11356\n  },\n  {\n    \"tag\": "conciliation",\n    \"popularity\": 11342\n  },\n  {\n    \"tag\": "supergun",\n    \"popularity\": 11327\n  },\n  {\n    \"tag\": "photoheliography",\n    \"popularity\": 11313\n  },\n  {\n    \"tag\": "cacosmia",\n    \"popularity\": 11299\n  },\n  {\n    \"tag\": "caressant",\n    \"popularity\": 11285\n  },\n  {\n    \"tag\": "swivet",\n    \"popularity\": 11270\n  },\n  {\n    \"tag\": "coddler",\n    \"popularity\": 11256\n  },\n  {\n    \"tag\": "rakehellish",\n    \"popularity\": 11242\n  },\n  {\n    \"tag\": "recohabitation",\n    \"popularity\": 11228\n  },\n  {\n    \"tag\": "postillator",\n    \"popularity\": 11214\n  },\n  {\n    \"tag\": "receipt",\n    \"popularity\": 11200\n  },\n  {\n    \"tag\": "nonconformistical",\n    \"popularity\": 11186\n  },\n  {\n    \"tag\": "unglorified",\n    \"popularity\": 11172\n  },\n  {\n    \"tag\": "unordinariness",\n    \"popularity\": 11158\n  },\n  {\n    \"tag\": "tetrahydroxy",\n    \"popularity\": 11144\n  },\n  {\n    \"tag\": "haploperistomic corporeity",\n    \"popularity\": 11130\n  },\n  {\n    \"tag\": "varical",\n    \"popularity\": 11117\n  },\n  {\n    \"tag\": "pilferment",\n    \"popularity\": 11103\n  },\n  {\n    \"tag\": "reverentially playcraft",\n    \"popularity\": 11089\n  },\n  {\n    \"tag\": "unretentive",\n    \"popularity\": 11075\n  },\n  {\n    \"tag\": "readiness",\n    \"popularity\": 11061\n  },\n  {\n    \"tag\": "thermomagnetism",\n    \"popularity\": 11048\n  },\n  {\n    \"tag\": "spotless",\n    \"popularity\": 11034\n  },\n  {\n    \"tag\": "semishrubby",\n    \"popularity\": 11020\n  },\n  {\n    \"tag\": "metrotomy",\n    \"popularity\": 11007\n  },\n  {\n    \"tag\": "hocker",\n    \"popularity\": 10993\n  },\n  {\n    \"tag\": "anecdotal",\n    \"popularity\": 10979\n  },\n  {\n    \"tag\": "tetrabelodont",\n    \"popularity\": 10966\n  },\n  {\n    \"tag\": "Ramillied",\n    \"popularity\": 10952\n  },\n  {\n    \"tag\": "sympatheticism",\n    \"popularity\": 10939\n  },\n  {\n    \"tag\": "kiskatom",\n    \"popularity\": 10925\n  },\n  {\n    \"tag\": "concyclically",\n    \"popularity\": 10912\n  },\n  {\n    \"tag\": "tunicless",\n    \"popularity\": 10899\n  },\n  {\n    \"tag\": "formalistic",\n    \"popularity\": 10885\n  },\n  {\n    \"tag\": "thermacogenesis",\n    \"popularity\": 10872\n  },\n  {\n    \"tag\": "multimotored",\n    \"popularity\": 10858\n  },\n  {\n    \"tag\": "inversive",\n    \"popularity\": 10845\n  },\n  {\n    \"tag\": "Jatki",\n    \"popularity\": 10832\n  },\n  {\n    \"tag\": "highest",\n    \"popularity\": 10818\n  },\n  {\n    \"tag\": "rubidic",\n    \"popularity\": 10805\n  },\n  {\n    \"tag\": "acranial",\n    \"popularity\": 10792\n  },\n  {\n    \"tag\": "pulvinulus",\n    \"popularity\": 10779\n  },\n  {\n    \"tag\": "nattiness",\n    \"popularity\": 10766\n  },\n  {\n    \"tag\": "antisimoniacal",\n    \"popularity\": 10752\n  },\n  {\n    \"tag\": "tetanize",\n    \"popularity\": 10739\n  },\n  {\n    \"tag\": "spectrophobia",\n    \"popularity\": 10726\n  },\n  {\n    \"tag\": "monopolitical",\n    \"popularity\": 10713\n  },\n  {\n    \"tag\": "teallite",\n    \"popularity\": 10700\n  },\n  {\n    \"tag\": "alicyclic interpellator",\n    \"popularity\": 10687\n  },\n  {\n    \"tag\": "nonsynthesized",\n    \"popularity\": 10674\n  },\n  {\n    \"tag\": "wheelwrighting",\n    \"popularity\": 10661\n  },\n  {\n    \"tag\": "pelliculate",\n    \"popularity\": 10648\n  },\n  {\n    \"tag\": "Euphyllopoda",\n    \"popularity\": 10635\n  },\n  {\n    \"tag\": "graver",\n    \"popularity\": 10622\n  },\n  {\n    \"tag\": "automorph",\n    \"popularity\": 10609\n  },\n  {\n    \"tag\": "underhanded",\n    \"popularity\": 10597\n  },\n  {\n    \"tag\": "causal",\n    \"popularity\": 10584\n  },\n  {\n    \"tag\": "odoom",\n    \"popularity\": 10571\n  },\n  {\n    \"tag\": "apodictical",\n    \"popularity\": 10558\n  },\n  {\n    \"tag\": "foundery",\n    \"popularity\": 10545\n  },\n  {\n    \"tag\": "unneighbored",\n    \"popularity\": 10533\n  },\n  {\n    \"tag\": "woolshearing",\n    \"popularity\": 10520\n  },\n  {\n    \"tag\": "boschveld",\n    \"popularity\": 10507\n  },\n  {\n    \"tag\": "unhardened lipopod",\n    \"popularity\": 10495\n  },\n  {\n    \"tag\": "unenriching",\n    \"popularity\": 10482\n  },\n  {\n    \"tag\": "spak",\n    \"popularity\": 10469\n  },\n  {\n    \"tag\": "yogasana",\n    \"popularity\": 10457\n  },\n  {\n    \"tag\": "depoetize",\n    \"popularity\": 10444\n  },\n  {\n    \"tag\": "parousiamania",\n    \"popularity\": 10432\n  },\n  {\n    \"tag\": "longlegs",\n    \"popularity\": 10419\n  },\n  {\n    \"tag\": "gelatinizability",\n    \"popularity\": 10407\n  },\n  {\n    \"tag\": "edeology",\n    \"popularity\": 10394\n  },\n  {\n    \"tag\": "sodwork",\n    \"popularity\": 10382\n  },\n  {\n    \"tag\": "somnambule",\n    \"popularity\": 10369\n  },\n  {\n    \"tag\": "antiquing",\n    \"popularity\": 10357\n  },\n  {\n    \"tag\": "intaker",\n    \"popularity\": 10344\n  },\n  {\n    \"tag\": "Gerberia",\n    \"popularity\": 10332\n  },\n  {\n    \"tag\": "preadmit",\n    \"popularity\": 10320\n  },\n  {\n    \"tag\": "bullhorn",\n    \"popularity\": 10307\n  },\n  {\n    \"tag\": "sororal",\n    \"popularity\": 10295\n  },\n  {\n    \"tag\": "phaeophyceous",\n    \"popularity\": 10283\n  },\n  {\n    \"tag\": "omphalopsychite",\n    \"popularity\": 10271\n  },\n  {\n    \"tag\": "substantious",\n    \"popularity\": 10258\n  },\n  {\n    \"tag\": "undemonstratively",\n    \"popularity\": 10246\n  },\n  {\n    \"tag\": "corallike blackit",\n    \"popularity\": 10234\n  },\n  {\n    \"tag\": "amoebous",\n    \"popularity\": 10222\n  },\n  {\n    \"tag\": "Polypodium",\n    \"popularity\": 10210\n  },\n  {\n    \"tag\": "blodite",\n    \"popularity\": 10198\n  },\n  {\n    \"tag\": "hordarian",\n    \"popularity\": 10186\n  },\n  {\n    \"tag\": "nonmoral",\n    \"popularity\": 10174\n  },\n  {\n    \"tag\": "dredgeful",\n    \"popularity\": 10162\n  },\n  {\n    \"tag\": "nourishingly",\n    \"popularity\": 10150\n  },\n  {\n    \"tag\": "seamy",\n    \"popularity\": 10138\n  },\n  {\n    \"tag\": "vara",\n    \"popularity\": 10126\n  },\n  {\n    \"tag\": "incorruptibleness",\n    \"popularity\": 10114\n  },\n  {\n    \"tag\": "manipulator",\n    \"popularity\": 10102\n  },\n  {\n    \"tag\": "chromodiascope uncountably",\n    \"popularity\": 10090\n  },\n  {\n    \"tag\": "typhemia",\n    \"popularity\": 10078\n  },\n  {\n    \"tag\": "Smalcaldic",\n    \"popularity\": 10066\n  },\n  {\n    \"tag\": "precontrive",\n    \"popularity\": 10054\n  },\n  {\n    \"tag\": "sowarry",\n    \"popularity\": 10042\n  },\n  {\n    \"tag\": "monopodic",\n    \"popularity\": 10031\n  },\n  {\n    \"tag\": "recodify",\n    \"popularity\": 10019\n  },\n  {\n    \"tag\": "phosphowolframic rimple",\n    \"popularity\": 10007\n  },\n  {\n    \"tag\": "triconch",\n    \"popularity\": 9995\n  },\n  {\n    \"tag\": "pycnodontoid",\n    \"popularity\": 9984\n  },\n  {\n    \"tag\": "bradyspermatism",\n    \"popularity\": 9972\n  },\n  {\n    \"tag\": "extensionist",\n    \"popularity\": 9960\n  },\n  {\n    \"tag\": "characterize",\n    \"popularity\": 9949\n  },\n  {\n    \"tag\": "anatreptic proteolytic",\n    \"popularity\": 9937\n  },\n  {\n    \"tag\": "waterboard",\n    \"popularity\": 9925\n  },\n  {\n    \"tag\": "allopathically",\n    \"popularity\": 9914\n  },\n  {\n    \"tag\": "arithmetician",\n    \"popularity\": 9902\n  },\n  {\n    \"tag\": "subsist",\n    \"popularity\": 9891\n  },\n  {\n    \"tag\": "Islamitish",\n    \"popularity\": 9879\n  },\n  {\n    \"tag\": "biddy",\n    \"popularity\": 9868\n  },\n  {\n    \"tag\": "reverberation",\n    \"popularity\": 9856\n  },\n  {\n    \"tag\": "Zaporogue",\n    \"popularity\": 9845\n  },\n  {\n    \"tag\": "soapberry",\n    \"popularity\": 9833\n  },\n  {\n    \"tag\": "physiognomics",\n    \"popularity\": 9822\n  },\n  {\n    \"tag\": "hospitalization",\n    \"popularity\": 9810\n  },\n  {\n    \"tag\": "dissembler",\n    \"popularity\": 9799\n  },\n  {\n    \"tag\": "festinate",\n    \"popularity\": 9788\n  },\n  {\n    \"tag\": "angiectopia",\n    \"popularity\": 9776\n  },\n  {\n    \"tag\": "Pulicidae",\n    \"popularity\": 9765\n  },\n  {\n    \"tag\": "beslimer",\n    \"popularity\": 9754\n  },\n  {\n    \"tag\": "nontreaty",\n    \"popularity\": 9743\n  },\n  {\n    \"tag\": "unhaggled",\n    \"popularity\": 9731\n  },\n  {\n    \"tag\": "catfall",\n    \"popularity\": 9720\n  },\n  {\n    \"tag\": "stola",\n    \"popularity\": 9709\n  },\n  {\n    \"tag\": "pataco",\n    \"popularity\": 9698\n  },\n  {\n    \"tag\": "ontologistic",\n    \"popularity\": 9686\n  },\n  {\n    \"tag\": "aerosphere",\n    \"popularity\": 9675\n  },\n  {\n    \"tag\": "deobstruent",\n    \"popularity\": 9664\n  },\n  {\n    \"tag\": "threepence",\n    \"popularity\": 9653\n  },\n  {\n    \"tag\": "cyprinoid",\n    \"popularity\": 9642\n  },\n  {\n    \"tag\": "overbank",\n    \"popularity\": 9631\n  },\n  {\n    \"tag\": "prostyle",\n    \"popularity\": 9620\n  },\n  {\n    \"tag\": "photoactivation",\n    \"popularity\": 9609\n  },\n  {\n    \"tag\": "homothetic",\n    \"popularity\": 9598\n  },\n  {\n    \"tag\": "roguedom",\n    \"popularity\": 9587\n  },\n  {\n    \"tag\": "underschool",\n    \"popularity\": 9576\n  },\n  {\n    \"tag\": "tractility",\n    \"popularity\": 9565\n  },\n  {\n    \"tag\": "gardenin",\n    \"popularity\": 9554\n  },\n  {\n    \"tag\": "Micromastictora",\n    \"popularity\": 9543\n  },\n  {\n    \"tag\": "gossypine",\n    \"popularity\": 9532\n  },\n  {\n    \"tag\": "amylodyspepsia",\n    \"popularity\": 9521\n  },\n  {\n    \"tag\": "Luciana",\n    \"popularity\": 9510\n  },\n  {\n    \"tag\": "meetly nonfisherman",\n    \"popularity\": 9500\n  },\n  {\n    \"tag\": "backhanded",\n    \"popularity\": 9489\n  },\n  {\n    \"tag\": "decrustation",\n    \"popularity\": 9478\n  },\n  {\n    \"tag\": "pinrail",\n    \"popularity\": 9467\n  },\n  {\n    \"tag\": "Mahori",\n    \"popularity\": 9456\n  },\n  {\n    \"tag\": "unsizable",\n    \"popularity\": 9446\n  },\n  {\n    \"tag\": "disawa",\n    \"popularity\": 9435\n  },\n  {\n    \"tag\": "launderability inconsidered",\n    \"popularity\": 9424\n  },\n  {\n    \"tag\": "unclassical",\n    \"popularity\": 9414\n  },\n  {\n    \"tag\": "inobtrusiveness",\n    \"popularity\": 9403\n  },\n  {\n    \"tag\": "sialogenous",\n    \"popularity\": 9392\n  },\n  {\n    \"tag\": "sulphonamide",\n    \"popularity\": 9382\n  },\n  {\n    \"tag\": "diluvion",\n    \"popularity\": 9371\n  },\n  {\n    \"tag\": "deuteranope",\n    \"popularity\": 9361\n  },\n  {\n    \"tag\": "addition",\n    \"popularity\": 9350\n  },\n  {\n    \"tag\": "bockeret",\n    \"popularity\": 9339\n  },\n  {\n    \"tag\": "unidentified",\n    \"popularity\": 9329\n  },\n  {\n    \"tag\": "caryatic",\n    \"popularity\": 9318\n  },\n  {\n    \"tag\": "misattribution",\n    \"popularity\": 9308\n  },\n  {\n    \"tag\": "outray",\n    \"popularity\": 9297\n  },\n  {\n    \"tag\": "areometrical",\n    \"popularity\": 9287\n  },\n  {\n    \"tag\": "antilogism",\n    \"popularity\": 9277\n  },\n  {\n    \"tag\": "inadjustable",\n    \"popularity\": 9266\n  },\n  {\n    \"tag\": "byssus",\n    \"popularity\": 9256\n  },\n  {\n    \"tag\": "trun",\n    \"popularity\": 9245\n  },\n  {\n    \"tag\": "thereology",\n    \"popularity\": 9235\n  },\n  {\n    \"tag\": "extort",\n    \"popularity\": 9225\n  },\n  {\n    \"tag\": "bumpkin",\n    \"popularity\": 9214\n  },\n  {\n    \"tag\": "sulphobenzide",\n    \"popularity\": 9204\n  },\n  {\n    \"tag\": "hydrogeology",\n    \"popularity\": 9194\n  },\n  {\n    \"tag\": "nidulariaceous",\n    \"popularity\": 9183\n  },\n  {\n    \"tag\": "propodiale",\n    \"popularity\": 9173\n  },\n  {\n    \"tag\": "fierily",\n    \"popularity\": 9163\n  },\n  {\n    \"tag\": "aerotonometry",\n    \"popularity\": 9153\n  },\n  {\n    \"tag\": "pelobatid oversuperstitious",\n    \"popularity\": 9142\n  },\n  {\n    \"tag\": "restringent",\n    \"popularity\": 9132\n  },\n  {\n    \"tag\": "tetrapodic",\n    \"popularity\": 9122\n  },\n  {\n    \"tag\": "heroicness Vendidad",\n    \"popularity\": 9112\n  },\n  {\n    \"tag\": "Sphingurus",\n    \"popularity\": 9102\n  },\n  {\n    \"tag\": "sclerote",\n    \"popularity\": 9092\n  },\n  {\n    \"tag\": "unkeyed",\n    \"popularity\": 9082\n  },\n  {\n    \"tag\": "superparliamentary",\n    \"popularity\": 9072\n  },\n  {\n    \"tag\": "hetericism",\n    \"popularity\": 9061\n  },\n  {\n    \"tag\": "hucklebone",\n    \"popularity\": 9051\n  },\n  {\n    \"tag\": "yojan",\n    \"popularity\": 9041\n  },\n  {\n    \"tag\": "bossed",\n    \"popularity\": 9031\n  },\n  {\n    \"tag\": "spiderwork",\n    \"popularity\": 9021\n  },\n  {\n    \"tag\": "millfeed dullery",\n    \"popularity\": 9011\n  },\n  {\n    \"tag\": "adnoun",\n    \"popularity\": 9001\n  },\n  {\n    \"tag\": "mesometric",\n    \"popularity\": 8992\n  },\n  {\n    \"tag\": "doublehandedness",\n    \"popularity\": 8982\n  },\n  {\n    \"tag\": "suppurant",\n    \"popularity\": 8972\n  },\n  {\n    \"tag\": "Berlinize",\n    \"popularity\": 8962\n  },\n  {\n    \"tag\": "sontag",\n    \"popularity\": 8952\n  },\n  {\n    \"tag\": "biplane",\n    \"popularity\": 8942\n  },\n  {\n    \"tag\": "insula",\n    \"popularity\": 8932\n  },\n  {\n    \"tag\": "unbrand",\n    \"popularity\": 8922\n  },\n  {\n    \"tag\": "Basilosaurus",\n    \"popularity\": 8913\n  },\n  {\n    \"tag\": "prenomination",\n    \"popularity\": 8903\n  },\n  {\n    \"tag\": "untextual",\n    \"popularity\": 8893\n  },\n  {\n    \"tag\": "coleslaw",\n    \"popularity\": 8883\n  },\n  {\n    \"tag\": "langsyne",\n    \"popularity\": 8874\n  },\n  {\n    \"tag\": "impede",\n    \"popularity\": 8864\n  },\n  {\n    \"tag\": "irrigator",\n    \"popularity\": 8854\n  },\n  {\n    \"tag\": "deflocculation",\n    \"popularity\": 8844\n  },\n  {\n    \"tag\": "narghile",\n    \"popularity\": 8835\n  },\n  {\n    \"tag\": "unguardedly ebenaceous",\n    \"popularity\": 8825\n  },\n  {\n    \"tag\": "conversantly subocular",\n    \"popularity\": 8815\n  },\n  {\n    \"tag\": "hydroponic",\n    \"popularity\": 8806\n  },\n  {\n    \"tag\": "anthropopsychism",\n    \"popularity\": 8796\n  },\n  {\n    \"tag\": "panoptic",\n    \"popularity\": 8787\n  },\n  {\n    \"tag\": "insufferable",\n    \"popularity\": 8777\n  },\n  {\n    \"tag\": "salema",\n    \"popularity\": 8768\n  },\n  {\n    \"tag\": "Myriapoda",\n    \"popularity\": 8758\n  },\n  {\n    \"tag\": "regarrison",\n    \"popularity\": 8748\n  },\n  {\n    \"tag\": "overlearned",\n    \"popularity\": 8739\n  },\n  {\n    \"tag\": "ultraroyalist conventical bureaucratical",\n    \"popularity\": 8729\n  },\n  {\n    \"tag\": "epicaridan",\n    \"popularity\": 8720\n  },\n  {\n    \"tag\": "poetastress",\n    \"popularity\": 8711\n  },\n  {\n    \"tag\": "monophthalmus",\n    \"popularity\": 8701\n  },\n  {\n    \"tag\": "simnel",\n    \"popularity\": 8692\n  },\n  {\n    \"tag\": "compotor",\n    \"popularity\": 8682\n  },\n  {\n    \"tag\": "hydrolase",\n    \"popularity\": 8673\n  },\n  {\n    \"tag\": "attemptless",\n    \"popularity\": 8663\n  },\n  {\n    \"tag\": "visceroptosis",\n    \"popularity\": 8654\n  },\n  {\n    \"tag\": "unpreparedly",\n    \"popularity\": 8645\n  },\n  {\n    \"tag\": "mastage",\n    \"popularity\": 8635\n  },\n  {\n    \"tag\": "preinfluence",\n    \"popularity\": 8626\n  },\n  {\n    \"tag\": "Siwan",\n    \"popularity\": 8617\n  },\n  {\n    \"tag\": "ceratotheca belvedere",\n    \"popularity\": 8607\n  },\n  {\n    \"tag\": "disenablement",\n    \"popularity\": 8598\n  },\n  {\n    \"tag\": "nine",\n    \"popularity\": 8589\n  },\n  {\n    \"tag\": "spellingdown abridgment",\n    \"popularity\": 8580\n  },\n  {\n    \"tag\": "twilightless",\n    \"popularity\": 8571\n  },\n  {\n    \"tag\": "overflow",\n    \"popularity\": 8561\n  },\n  {\n    \"tag\": "mismeasurement",\n    \"popularity\": 8552\n  },\n  {\n    \"tag\": "nawabship",\n    \"popularity\": 8543\n  },\n  {\n    \"tag\": "Phrynosoma",\n    \"popularity\": 8534\n  },\n  {\n    \"tag\": "unanticipatingly",\n    \"popularity\": 8525\n  },\n  {\n    \"tag\": "blankite",\n    \"popularity\": 8516\n  },\n  {\n    \"tag\": "role",\n    \"popularity\": 8506\n  },\n  {\n    \"tag\": "peperine edelweiss",\n    \"popularity\": 8497\n  },\n  {\n    \"tag\": "unhysterical",\n    \"popularity\": 8488\n  },\n  {\n    \"tag\": "attentiveness",\n    \"popularity\": 8479\n  },\n  {\n    \"tag\": "scintillant",\n    \"popularity\": 8470\n  },\n  {\n    \"tag\": "stenostomatous",\n    \"popularity\": 8461\n  },\n  {\n    \"tag\": "pectinite",\n    \"popularity\": 8452\n  },\n  {\n    \"tag\": "herring",\n    \"popularity\": 8443\n  },\n  {\n    \"tag\": "interroom",\n    \"popularity\": 8434\n  },\n  {\n    \"tag\": "laccol",\n    \"popularity\": 8425\n  },\n  {\n    \"tag\": "unpartably kylite",\n    \"popularity\": 8416\n  },\n  {\n    \"tag\": "spirivalve",\n    \"popularity\": 8407\n  },\n  {\n    \"tag\": "hoosegow",\n    \"popularity\": 8398\n  },\n  {\n    \"tag\": "doat",\n    \"popularity\": 8389\n  },\n  {\n    \"tag\": "amphibian",\n    \"popularity\": 8380\n  },\n  {\n    \"tag\": "exposit",\n    \"popularity\": 8371\n  },\n  {\n    \"tag\": "canopy",\n    \"popularity\": 8363\n  },\n  {\n    \"tag\": "houndlike",\n    \"popularity\": 8354\n  },\n  {\n    \"tag\": "spikebill",\n    \"popularity\": 8345\n  },\n  {\n    \"tag\": "wiseacre pyrotechnic",\n    \"popularity\": 8336\n  },\n  {\n    \"tag\": "confessingly woodman",\n    \"popularity\": 8327\n  },\n  {\n    \"tag\": "overside",\n    \"popularity\": 8318\n  },\n  {\n    \"tag\": "oftwhiles",\n    \"popularity\": 8310\n  },\n  {\n    \"tag\": "Musophagidae",\n    \"popularity\": 8301\n  },\n  {\n    \"tag\": "slumberer",\n    \"popularity\": 8292\n  },\n  {\n    \"tag\": "leiotrichy",\n    \"popularity\": 8283\n  },\n  {\n    \"tag\": "Mantispidae",\n    \"popularity\": 8275\n  },\n  {\n    \"tag\": "perceptually",\n    \"popularity\": 8266\n  },\n  {\n    \"tag\": "biller",\n    \"popularity\": 8257\n  },\n  {\n    \"tag\": "eudaemonical",\n    \"popularity\": 8249\n  },\n  {\n    \"tag\": "underfiend",\n    \"popularity\": 8240\n  },\n  {\n    \"tag\": "impartible",\n    \"popularity\": 8231\n  },\n  {\n    \"tag\": "saxicavous",\n    \"popularity\": 8223\n  },\n  {\n    \"tag\": "yapster",\n    \"popularity\": 8214\n  },\n  {\n    \"tag\": "aliseptal",\n    \"popularity\": 8205\n  },\n  {\n    \"tag\": "omniparient",\n    \"popularity\": 8197\n  },\n  {\n    \"tag\": "nishiki",\n    \"popularity\": 8188\n  },\n  {\n    \"tag\": "yuzluk",\n    \"popularity\": 8180\n  },\n  {\n    \"tag\": "solderer",\n    \"popularity\": 8171\n  },\n  {\n    \"tag\": "Pinna",\n    \"popularity\": 8162\n  },\n  {\n    \"tag\": "reinterfere",\n    \"popularity\": 8154\n  },\n  {\n    \"tag\": "superepic",\n    \"popularity\": 8145\n  },\n  {\n    \"tag\": "ronquil",\n    \"popularity\": 8137\n  },\n  {\n    \"tag\": "bratstvo",\n    \"popularity\": 8128\n  },\n  {\n    \"tag\": "Thea",\n    \"popularity\": 8120\n  },\n  {\n    \"tag\": "hermaphroditical",\n    \"popularity\": 8111\n  },\n  {\n    \"tag\": "enlief",\n    \"popularity\": 8103\n  },\n  {\n    \"tag\": "Jesuate",\n    \"popularity\": 8095\n  },\n  {\n    \"tag\": "gaysome",\n    \"popularity\": 8086\n  },\n  {\n    \"tag\": "iliohypogastric",\n    \"popularity\": 8078\n  },\n  {\n    \"tag\": "regardance",\n    \"popularity\": 8069\n  },\n  {\n    \"tag\": "cumulately",\n    \"popularity\": 8061\n  },\n  {\n    \"tag\": "haustorial nucleolocentrosome",\n    \"popularity\": 8053\n  },\n  {\n    \"tag\": "cosmocrat",\n    \"popularity\": 8044\n  },\n  {\n    \"tag\": "onyxitis",\n    \"popularity\": 8036\n  },\n  {\n    \"tag\": "Cabinda",\n    \"popularity\": 8028\n  },\n  {\n    \"tag\": "coresort",\n    \"popularity\": 8019\n  },\n  {\n    \"tag\": "drusy preformant",\n    \"popularity\": 8011\n  },\n  {\n    \"tag\": "piningly",\n    \"popularity\": 8003\n  },\n  {\n    \"tag\": "bootlessly",\n    \"popularity\": 7994\n  },\n  {\n    \"tag\": "talari",\n    \"popularity\": 7986\n  },\n  {\n    \"tag\": "amidoacetal",\n    \"popularity\": 7978\n  },\n  {\n    \"tag\": "pschent",\n    \"popularity\": 7970\n  },\n  {\n    \"tag\": "consumptional scarer titivate",\n    \"popularity\": 7962\n  },\n  {\n    \"tag\": "Anserinae",\n    \"popularity\": 7953\n  },\n  {\n    \"tag\": "flaunter",\n    \"popularity\": 7945\n  },\n  {\n    \"tag\": "reindeer",\n    \"popularity\": 7937\n  },\n  {\n    \"tag\": "disparage",\n    \"popularity\": 7929\n  },\n  {\n    \"tag\": "superheat",\n    \"popularity\": 7921\n  },\n  {\n    \"tag\": "Chromatium",\n    \"popularity\": 7912\n  },\n  {\n    \"tag\": "Tina",\n    \"popularity\": 7904\n  },\n  {\n    \"tag\": "rededicatory",\n    \"popularity\": 7896\n  },\n  {\n    \"tag\": "nontransient",\n    \"popularity\": 7888\n  },\n  {\n    \"tag\": "Phocaean brinkless",\n    \"popularity\": 7880\n  },\n  {\n    \"tag\": "ventriculose",\n    \"popularity\": 7872\n  },\n  {\n    \"tag\": "upplough",\n    \"popularity\": 7864\n  },\n  {\n    \"tag\": "succorless",\n    \"popularity\": 7856\n  },\n  {\n    \"tag\": "hayrake",\n    \"popularity\": 7848\n  },\n  {\n    \"tag\": "merriness amorphia",\n    \"popularity\": 7840\n  },\n  {\n    \"tag\": "merycism",\n    \"popularity\": 7832\n  },\n  {\n    \"tag\": "checkrow",\n    \"popularity\": 7824\n  },\n  {\n    \"tag\": "scry",\n    \"popularity\": 7816\n  },\n  {\n    \"tag\": "obvolve",\n    \"popularity\": 7808\n  },\n  {\n    \"tag\": "orchard",\n    \"popularity\": 7800\n  },\n  {\n    \"tag\": "isomerize",\n    \"popularity\": 7792\n  },\n  {\n    \"tag\": "competitrix",\n    \"popularity\": 7784\n  },\n  {\n    \"tag\": "unbannered",\n    \"popularity\": 7776\n  },\n  {\n    \"tag\": "undoctrined",\n    \"popularity\": 7768\n  },\n  {\n    \"tag\": "theologian",\n    \"popularity\": 7760\n  },\n  {\n    \"tag\": "nebby",\n    \"popularity\": 7752\n  },\n  {\n    \"tag\": "Cardiazol",\n    \"popularity\": 7745\n  },\n  {\n    \"tag\": "phagedenic",\n    \"popularity\": 7737\n  },\n  {\n    \"tag\": "nostalgic",\n    \"popularity\": 7729\n  },\n  {\n    \"tag\": "orthodoxy",\n    \"popularity\": 7721\n  },\n  {\n    \"tag\": "oversanguine",\n    \"popularity\": 7713\n  },\n  {\n    \"tag\": "lish",\n    \"popularity\": 7705\n  },\n  {\n    \"tag\": "ketogenic",\n    \"popularity\": 7698\n  },\n  {\n    \"tag\": "syndicalize",\n    \"popularity\": 7690\n  },\n  {\n    \"tag\": "leeftail",\n    \"popularity\": 7682\n  },\n  {\n    \"tag\": "bulbomedullary",\n    \"popularity\": 7674\n  },\n  {\n    \"tag\": "reletter",\n    \"popularity\": 7667\n  },\n  {\n    \"tag\": "bitterly",\n    \"popularity\": 7659\n  },\n  {\n    \"tag\": "participatory",\n    \"popularity\": 7651\n  },\n  {\n    \"tag\": "baldberry",\n    \"popularity\": 7643\n  },\n  {\n    \"tag\": "prowaterpower",\n    \"popularity\": 7636\n  },\n  {\n    \"tag\": "lexicographical",\n    \"popularity\": 7628\n  },\n  {\n    \"tag\": "Anisodactyli",\n    \"popularity\": 7620\n  },\n  {\n    \"tag\": "amphipodous",\n    \"popularity\": 7613\n  },\n  {\n    \"tag\": "triglandular",\n    \"popularity\": 7605\n  },\n  {\n    \"tag\": "xanthopsin",\n    \"popularity\": 7597\n  },\n  {\n    \"tag\": "indefinitude",\n    \"popularity\": 7590\n  },\n  {\n    \"tag\": "bookworm",\n    \"popularity\": 7582\n  },\n  {\n    \"tag\": "suffocative",\n    \"popularity\": 7574\n  },\n  {\n    \"tag\": "uncongested tyrant",\n    \"popularity\": 7567\n  },\n  {\n    \"tag\": "alow harmoniously Pamir",\n    \"popularity\": 7559\n  },\n  {\n    \"tag\": "monander",\n    \"popularity\": 7552\n  },\n  {\n    \"tag\": "bagatelle",\n    \"popularity\": 7544\n  },\n  {\n    \"tag\": "membranology",\n    \"popularity\": 7537\n  },\n  {\n    \"tag\": "parturifacient",\n    \"popularity\": 7529\n  },\n  {\n    \"tag\": "excitovascular",\n    \"popularity\": 7522\n  },\n  {\n    \"tag\": "homopolar",\n    \"popularity\": 7514\n  },\n  {\n    \"tag\": "phobiac",\n    \"popularity\": 7507\n  },\n  {\n    \"tag\": "clype",\n    \"popularity\": 7499\n  },\n  {\n    \"tag\": "unsubversive",\n    \"popularity\": 7492\n  },\n  {\n    \"tag\": "bostrychoidal scorpionwort",\n    \"popularity\": 7484\n  },\n  {\n    \"tag\": "biliteralism",\n    \"popularity\": 7477\n  },\n  {\n    \"tag\": "dentatocostate",\n    \"popularity\": 7469\n  },\n  {\n    \"tag\": "Pici",\n    \"popularity\": 7462\n  },\n  {\n    \"tag\": "sideritic",\n    \"popularity\": 7454\n  },\n  {\n    \"tag\": "syntaxis",\n    \"popularity\": 7447\n  },\n  {\n    \"tag\": "ingest",\n    \"popularity\": 7440\n  },\n  {\n    \"tag\": "rigmarolish",\n    \"popularity\": 7432\n  },\n  {\n    \"tag\": "ocreaceous",\n    \"popularity\": 7425\n  },\n  {\n    \"tag\": "hyperbrachyskelic",\n    \"popularity\": 7418\n  },\n  {\n    \"tag\": "basophobia",\n    \"popularity\": 7410\n  },\n  {\n    \"tag\": "substantialness",\n    \"popularity\": 7403\n  },\n  {\n    \"tag\": "agglutinoid",\n    \"popularity\": 7396\n  },\n  {\n    \"tag\": "longleaf",\n    \"popularity\": 7388\n  },\n  {\n    \"tag\": "electroengraving",\n    \"popularity\": 7381\n  },\n  {\n    \"tag\": "laparoenterotomy",\n    \"popularity\": 7374\n  },\n  {\n    \"tag\": "oxalylurea",\n    \"popularity\": 7366\n  },\n  {\n    \"tag\": "unattaintedly",\n    \"popularity\": 7359\n  },\n  {\n    \"tag\": "pennystone",\n    \"popularity\": 7352\n  },\n  {\n    \"tag\": "Plumbaginaceae",\n    \"popularity\": 7345\n  },\n  {\n    \"tag\": "horntip",\n    \"popularity\": 7337\n  },\n  {\n    \"tag\": "begrudge",\n    \"popularity\": 7330\n  },\n  {\n    \"tag\": "bechignoned",\n    \"popularity\": 7323\n  },\n  {\n    \"tag\": "hologonidium",\n    \"popularity\": 7316\n  },\n  {\n    \"tag\": "Pulian",\n    \"popularity\": 7309\n  },\n  {\n    \"tag\": "gratulation",\n    \"popularity\": 7301\n  },\n  {\n    \"tag\": "Sebright",\n    \"popularity\": 7294\n  },\n  {\n    \"tag\": "coinstantaneous emotionally",\n    \"popularity\": 7287\n  },\n  {\n    \"tag\": "thoracostracan",\n    \"popularity\": 7280\n  },\n  {\n    \"tag\": "saurodont",\n    \"popularity\": 7273\n  },\n  {\n    \"tag\": "coseat",\n    \"popularity\": 7266\n  },\n  {\n    \"tag\": "irascibility",\n    \"popularity\": 7259\n  },\n  {\n    \"tag\": "occlude",\n    \"popularity\": 7251\n  },\n  {\n    \"tag\": "metallurgist",\n    \"popularity\": 7244\n  },\n  {\n    \"tag\": "extraviolet",\n    \"popularity\": 7237\n  },\n  {\n    \"tag\": "clinic",\n    \"popularity\": 7230\n  },\n  {\n    \"tag\": "skater",\n    \"popularity\": 7223\n  },\n  {\n    \"tag\": "linguistic",\n    \"popularity\": 7216\n  },\n  {\n    \"tag\": "attacheship",\n    \"popularity\": 7209\n  },\n  {\n    \"tag\": "Rachianectes",\n    \"popularity\": 7202\n  },\n  {\n    \"tag\": "foliolose",\n    \"popularity\": 7195\n  },\n  {\n    \"tag\": "claudetite",\n    \"popularity\": 7188\n  },\n  {\n    \"tag\": "aphidian scratching",\n    \"popularity\": 7181\n  },\n  {\n    \"tag\": "Carida",\n    \"popularity\": 7174\n  },\n  {\n    \"tag\": "tiepin polymicroscope",\n    \"popularity\": 7167\n  },\n  {\n    \"tag\": "telpherage",\n    \"popularity\": 7160\n  },\n  {\n    \"tag\": "meek",\n    \"popularity\": 7153\n  },\n  {\n    \"tag\": "swiftness",\n    \"popularity\": 7146\n  },\n  {\n    \"tag\": "gentes",\n    \"popularity\": 7139\n  },\n  {\n    \"tag\": "uncommemorated",\n    \"popularity\": 7132\n  },\n  {\n    \"tag\": "Lazarus",\n    \"popularity\": 7125\n  },\n  {\n    \"tag\": "redivive",\n    \"popularity\": 7119\n  },\n  {\n    \"tag\": "nonfebrile",\n    \"popularity\": 7112\n  },\n  {\n    \"tag\": "nymphet",\n    \"popularity\": 7105\n  },\n  {\n    \"tag\": "areologically",\n    \"popularity\": 7098\n  },\n  {\n    \"tag\": "undonkey",\n    \"popularity\": 7091\n  },\n  {\n    \"tag\": "projecting",\n    \"popularity\": 7084\n  },\n  {\n    \"tag\": "pinnigrade",\n    \"popularity\": 7077\n  },\n  {\n    \"tag\": "butylation",\n    \"popularity\": 7071\n  },\n  {\n    \"tag\": "philologistic lenticle",\n    \"popularity\": 7064\n  },\n  {\n    \"tag\": "nooky",\n    \"popularity\": 7057\n  },\n  {\n    \"tag\": "incestuousness",\n    \"popularity\": 7050\n  },\n  {\n    \"tag\": "palingenetically",\n    \"popularity\": 7043\n  },\n  {\n    \"tag\": "mitochondria",\n    \"popularity\": 7037\n  },\n  {\n    \"tag\": "truthify",\n    \"popularity\": 7030\n  },\n  {\n    \"tag\": "titanyl",\n    \"popularity\": 7023\n  },\n  {\n    \"tag\": "bestride",\n    \"popularity\": 7016\n  },\n  {\n    \"tag\": "chende",\n    \"popularity\": 7010\n  },\n  {\n    \"tag\": "Chaucerian monophote",\n    \"popularity\": 7003\n  },\n  {\n    \"tag\": "cutback",\n    \"popularity\": 6996\n  },\n  {\n    \"tag\": "unpatiently",\n    \"popularity\": 6989\n  },\n  {\n    \"tag\": "subvitreous",\n    \"popularity\": 6983\n  },\n  {\n    \"tag\": "organizable",\n    \"popularity\": 6976\n  },\n  {\n    \"tag\": "anniverse uncomprehensible",\n    \"popularity\": 6969\n  },\n  {\n    \"tag\": "hyalescence",\n    \"popularity\": 6963\n  },\n  {\n    \"tag\": "amniochorial",\n    \"popularity\": 6956\n  },\n  {\n    \"tag\": "Corybantian",\n    \"popularity\": 6949\n  },\n  {\n    \"tag\": "genocide Scaphitidae",\n    \"popularity\": 6943\n  },\n  {\n    \"tag\": "accordionist",\n    \"popularity\": 6936\n  },\n  {\n    \"tag\": "becheck",\n    \"popularity\": 6930\n  },\n  {\n    \"tag\": "overproduce",\n    \"popularity\": 6923\n  },\n  {\n    \"tag\": "unmaniac frijolillo",\n    \"popularity\": 6916\n  },\n  {\n    \"tag\": "multisulcated",\n    \"popularity\": 6910\n  },\n  {\n    \"tag\": "wennebergite",\n    \"popularity\": 6903\n  },\n  {\n    \"tag\": "tautousious mowth",\n    \"popularity\": 6897\n  },\n  {\n    \"tag\": "marigold",\n    \"popularity\": 6890\n  },\n  {\n    \"tag\": "affray",\n    \"popularity\": 6884\n  },\n  {\n    \"tag\": "nonidolatrous",\n    \"popularity\": 6877\n  },\n  {\n    \"tag\": "aphrasia",\n    \"popularity\": 6871\n  },\n  {\n    \"tag\": "muddlingly",\n    \"popularity\": 6864\n  },\n  {\n    \"tag\": "clear",\n    \"popularity\": 6858\n  },\n  {\n    \"tag\": "Clitoria",\n    \"popularity\": 6851\n  },\n  {\n    \"tag\": "apportionment underwaist",\n    \"popularity\": 6845\n  },\n  {\n    \"tag\": "kodakist",\n    \"popularity\": 6838\n  },\n  {\n    \"tag\": "Momotidae",\n    \"popularity\": 6832\n  },\n  {\n    \"tag\": "cryptovalency",\n    \"popularity\": 6825\n  },\n  {\n    \"tag\": "floe",\n    \"popularity\": 6819\n  },\n  {\n    \"tag\": "aphagia",\n    \"popularity\": 6812\n  },\n  {\n    \"tag\": "brontograph",\n    \"popularity\": 6806\n  },\n  {\n    \"tag\": "tubulous",\n    \"popularity\": 6799\n  },\n  {\n    \"tag\": "unhorse",\n    \"popularity\": 6793\n  },\n  {\n    \"tag\": "chlordane",\n    \"popularity\": 6787\n  },\n  {\n    \"tag\": "colloquy brochan",\n    \"popularity\": 6780\n  },\n  {\n    \"tag\": "sloosh",\n    \"popularity\": 6774\n  },\n  {\n    \"tag\": "battered",\n    \"popularity\": 6767\n  },\n  {\n    \"tag\": "monocularity pluriguttulate",\n    \"popularity\": 6761\n  },\n  {\n    \"tag\": "chiastoneury",\n    \"popularity\": 6755\n  },\n  {\n    \"tag\": "Sanguinaria",\n    \"popularity\": 6748\n  },\n  {\n    \"tag\": "confessionary",\n    \"popularity\": 6742\n  },\n  {\n    \"tag\": "enzymic",\n    \"popularity\": 6736\n  },\n  {\n    \"tag\": "cord",\n    \"popularity\": 6729\n  },\n  {\n    \"tag\": "oviducal",\n    \"popularity\": 6723\n  },\n  {\n    \"tag\": "crozzle outsea",\n    \"popularity\": 6717\n  },\n  {\n    \"tag\": "balladical",\n    \"popularity\": 6710\n  },\n  {\n    \"tag\": "uncollectibleness",\n    \"popularity\": 6704\n  },\n  {\n    \"tag\": "predorsal",\n    \"popularity\": 6698\n  },\n  {\n    \"tag\": "reauthenticate",\n    \"popularity\": 6692\n  },\n  {\n    \"tag\": "ravissant",\n    \"popularity\": 6685\n  },\n  {\n    \"tag\": "advantageousness",\n    \"popularity\": 6679\n  },\n  {\n    \"tag\": "rung",\n    \"popularity\": 6673\n  },\n  {\n    \"tag\": "duncedom",\n    \"popularity\": 6667\n  },\n  {\n    \"tag\": "hematolite",\n    \"popularity\": 6660\n  },\n  {\n    \"tag\": "thisness",\n    \"popularity\": 6654\n  },\n  {\n    \"tag\": "mapau",\n    \"popularity\": 6648\n  },\n  {\n    \"tag\": "Hecatic",\n    \"popularity\": 6642\n  },\n  {\n    \"tag\": "meningoencephalocele",\n    \"popularity\": 6636\n  },\n  {\n    \"tag\": "confection sorra",\n    \"popularity\": 6630\n  },\n  {\n    \"tag\": "unsedate",\n    \"popularity\": 6623\n  },\n  {\n    \"tag\": "meningocerebritis",\n    \"popularity\": 6617\n  },\n  {\n    \"tag\": "biopsychological",\n    \"popularity\": 6611\n  },\n  {\n    \"tag\": "clavicithern",\n    \"popularity\": 6605\n  },\n  {\n    \"tag\": "resun",\n    \"popularity\": 6599\n  },\n  {\n    \"tag\": "bayamo",\n    \"popularity\": 6593\n  },\n  {\n    \"tag\": "seeableness",\n    \"popularity\": 6587\n  },\n  {\n    \"tag\": "hypsidolichocephalism",\n    \"popularity\": 6581\n  },\n  {\n    \"tag\": "salivous",\n    \"popularity\": 6574\n  },\n  {\n    \"tag\": "neumatize",\n    \"popularity\": 6568\n  },\n  {\n    \"tag\": "stree",\n    \"popularity\": 6562\n  },\n  {\n    \"tag\": "markshot",\n    \"popularity\": 6556\n  },\n  {\n    \"tag\": "phraseologically",\n    \"popularity\": 6550\n  },\n  {\n    \"tag\": "yealing",\n    \"popularity\": 6544\n  },\n  {\n    \"tag\": "puggy",\n    \"popularity\": 6538\n  },\n  {\n    \"tag\": "sexadecimal",\n    \"popularity\": 6532\n  },\n  {\n    \"tag\": "unofficerlike",\n    \"popularity\": 6526\n  },\n  {\n    \"tag\": "curiosa",\n    \"popularity\": 6520\n  },\n  {\n    \"tag\": "pedomotor",\n    \"popularity\": 6514\n  },\n  {\n    \"tag\": "astrally",\n    \"popularity\": 6508\n  },\n  {\n    \"tag\": "prosomatic",\n    \"popularity\": 6502\n  },\n  {\n    \"tag\": "bulletheaded",\n    \"popularity\": 6496\n  },\n  {\n    \"tag\": "fortuned",\n    \"popularity\": 6490\n  },\n  {\n    \"tag\": "pixy",\n    \"popularity\": 6484\n  },\n  {\n    \"tag\": "protectrix",\n    \"popularity\": 6478\n  },\n  {\n    \"tag\": "arthritical",\n    \"popularity\": 6472\n  },\n  {\n    \"tag\": "coction",\n    \"popularity\": 6466\n  },\n  {\n    \"tag\": "Anthropos",\n    \"popularity\": 6460\n  },\n  {\n    \"tag\": "runer",\n    \"popularity\": 6454\n  },\n  {\n    \"tag\": "prenotify",\n    \"popularity\": 6449\n  },\n  {\n    \"tag\": "microspheric gastroparalysis",\n    \"popularity\": 6443\n  },\n  {\n    \"tag\": "Jovicentrical",\n    \"popularity\": 6437\n  },\n  {\n    \"tag\": "ceratopsid",\n    \"popularity\": 6431\n  },\n  {\n    \"tag\": "Theodoric",\n    \"popularity\": 6425\n  },\n  {\n    \"tag\": "Pactolus",\n    \"popularity\": 6419\n  },\n  {\n    \"tag\": "spawning",\n    \"popularity\": 6413\n  },\n  {\n    \"tag\": "nonconfidential",\n    \"popularity\": 6407\n  },\n  {\n    \"tag\": "halotrichite infumate",\n    \"popularity\": 6402\n  },\n  {\n    \"tag\": "undiscriminatingly",\n    \"popularity\": 6396\n  },\n  {\n    \"tag\": "unexasperated",\n    \"popularity\": 6390\n  },\n  {\n    \"tag\": "isoeugenol",\n    \"popularity\": 6384\n  },\n  {\n    \"tag\": "pressboard",\n    \"popularity\": 6378\n  },\n  {\n    \"tag\": "unshrew",\n    \"popularity\": 6372\n  },\n  {\n    \"tag\": "huffingly",\n    \"popularity\": 6367\n  },\n  {\n    \"tag\": "wagaun",\n    \"popularity\": 6361\n  },\n  {\n    \"tag\": "squirt Philistine",\n    \"popularity\": 6355\n  },\n  {\n    \"tag\": "kryptic",\n    \"popularity\": 6349\n  },\n  {\n    \"tag\": "paraform",\n    \"popularity\": 6344\n  },\n  {\n    \"tag\": "preverify",\n    \"popularity\": 6338\n  },\n  {\n    \"tag\": "dalar",\n    \"popularity\": 6332\n  },\n  {\n    \"tag\": "interdictor appraisingly",\n    \"popularity\": 6326\n  },\n  {\n    \"tag\": "chipped",\n    \"popularity\": 6321\n  },\n  {\n    \"tag\": "Pteropoda",\n    \"popularity\": 6315\n  },\n  {\n    \"tag\": "Bohairic",\n    \"popularity\": 6309\n  },\n  {\n    \"tag\": "felting",\n    \"popularity\": 6303\n  },\n  {\n    \"tag\": "compurgatorial",\n    \"popularity\": 6298\n  },\n  {\n    \"tag\": "unclead",\n    \"popularity\": 6292\n  },\n  {\n    \"tag\": "stockish",\n    \"popularity\": 6286\n  },\n  {\n    \"tag\": "mulligatawny",\n    \"popularity\": 6281\n  },\n  {\n    \"tag\": "Monotheletism",\n    \"popularity\": 6275\n  },\n  {\n    \"tag\": "lutanist",\n    \"popularity\": 6269\n  },\n  {\n    \"tag\": "gluttonize",\n    \"popularity\": 6264\n  },\n  {\n    \"tag\": "hackneyed",\n    \"popularity\": 6258\n  },\n  {\n    \"tag\": "yield",\n    \"popularity\": 6253\n  },\n  {\n    \"tag\": "sulphonamido",\n    \"popularity\": 6247\n  },\n  {\n    \"tag\": "granulative",\n    \"popularity\": 6241\n  },\n  {\n    \"tag\": "swingy",\n    \"popularity\": 6236\n  },\n  {\n    \"tag\": "Desmidiales",\n    \"popularity\": 6230\n  },\n  {\n    \"tag\": "tootlish",\n    \"popularity\": 6224\n  },\n  {\n    \"tag\": "unsatisfiedly",\n    \"popularity\": 6219\n  },\n  {\n    \"tag\": "burucha",\n    \"popularity\": 6213\n  },\n  {\n    \"tag\": "premeditatingly",\n    \"popularity\": 6208\n  },\n  {\n    \"tag\": "cowrie",\n    \"popularity\": 6202\n  },\n  {\n    \"tag\": "pleurolysis",\n    \"popularity\": 6197\n  },\n  {\n    \"tag\": "nationalist",\n    \"popularity\": 6191\n  },\n  {\n    \"tag\": "Pholadacea",\n    \"popularity\": 6186\n  },\n  {\n    \"tag\": "anakrousis",\n    \"popularity\": 6180\n  },\n  {\n    \"tag\": "proctorial",\n    \"popularity\": 6175\n  },\n  {\n    \"tag\": "cavillation",\n    \"popularity\": 6169\n  },\n  {\n    \"tag\": "cervicobregmatic",\n    \"popularity\": 6163\n  },\n  {\n    \"tag\": "interspecific",\n    \"popularity\": 6158\n  },\n  {\n    \"tag\": "Teutonity",\n    \"popularity\": 6152\n  },\n  {\n    \"tag\": "snakeholing",\n    \"popularity\": 6147\n  },\n  {\n    \"tag\": "balcony",\n    \"popularity\": 6142\n  },\n  {\n    \"tag\": "latchless",\n    \"popularity\": 6136\n  },\n  {\n    \"tag\": "Mithraea",\n    \"popularity\": 6131\n  },\n  {\n    \"tag\": "pseudepigraph",\n    \"popularity\": 6125\n  },\n  {\n    \"tag\": "flosser",\n    \"popularity\": 6120\n  },\n  {\n    \"tag\": "kotyle",\n    \"popularity\": 6114\n  },\n  {\n    \"tag\": "outdo",\n    \"popularity\": 6109\n  },\n  {\n    \"tag\": "interclerical",\n    \"popularity\": 6103\n  },\n  {\n    \"tag\": "aurar",\n    \"popularity\": 6098\n  },\n  {\n    \"tag\": "apophyseal",\n    \"popularity\": 6093\n  },\n  {\n    \"tag\": "Miro",\n    \"popularity\": 6087\n  },\n  {\n    \"tag\": "Priscillian",\n    \"popularity\": 6082\n  },\n  {\n    \"tag\": "alluvia",\n    \"popularity\": 6076\n  },\n  {\n    \"tag\": "exordize",\n    \"popularity\": 6071\n  },\n  {\n    \"tag\": "breakage",\n    \"popularity\": 6066\n  },\n  {\n    \"tag\": "unclosable",\n    \"popularity\": 6060\n  },\n  {\n    \"tag\": "monocondylous",\n    \"popularity\": 6055\n  },\n  {\n    \"tag\": "dyarchy",\n    \"popularity\": 6050\n  },\n  {\n    \"tag\": "subchelate",\n    \"popularity\": 6044\n  },\n  {\n    \"tag\": "hearsay",\n    \"popularity\": 6039\n  },\n  {\n    \"tag\": "prestigiously",\n    \"popularity\": 6034\n  },\n  {\n    \"tag\": "unimuscular",\n    \"popularity\": 6028\n  },\n  {\n    \"tag\": "lingwort",\n    \"popularity\": 6023\n  },\n  {\n    \"tag\": "jealous",\n    \"popularity\": 6018\n  },\n  {\n    \"tag\": "artilleryman",\n    \"popularity\": 6012\n  },\n  {\n    \"tag\": "phantasmagorially",\n    \"popularity\": 6007\n  },\n  {\n    \"tag\": "stagnum",\n    \"popularity\": 6002\n  },\n  {\n    \"tag\": "organotropism shatteringly",\n    \"popularity\": 5997\n  },\n  {\n    \"tag\": "Mytilus Hebraist",\n    \"popularity\": 5991\n  },\n  {\n    \"tag\": "returf",\n    \"popularity\": 5986\n  },\n  {\n    \"tag\": "townfolk",\n    \"popularity\": 5981\n  },\n  {\n    \"tag\": "propitiative",\n    \"popularity\": 5976\n  },\n  {\n    \"tag\": "Anita unsullied",\n    \"popularity\": 5970\n  },\n  {\n    \"tag\": "bandoleered",\n    \"popularity\": 5965\n  },\n  {\n    \"tag\": "cubby",\n    \"popularity\": 5960\n  },\n  {\n    \"tag\": "Hexanchus",\n    \"popularity\": 5955\n  },\n  {\n    \"tag\": "circuminsular",\n    \"popularity\": 5949\n  },\n  {\n    \"tag\": "chamberletted eumycete",\n    \"popularity\": 5944\n  },\n  {\n    \"tag\": "secure",\n    \"popularity\": 5939\n  },\n  {\n    \"tag\": "Edwardean",\n    \"popularity\": 5934\n  },\n  {\n    \"tag\": "strenth",\n    \"popularity\": 5929\n  },\n  {\n    \"tag\": "exhaustless",\n    \"popularity\": 5923\n  },\n  {\n    \"tag\": "electioneerer",\n    \"popularity\": 5918\n  },\n  {\n    \"tag\": "estoile",\n    \"popularity\": 5913\n  },\n  {\n    \"tag\": "redden",\n    \"popularity\": 5908\n  },\n  {\n    \"tag\": "solicitee",\n    \"popularity\": 5903\n  },\n  {\n    \"tag\": "nonpatented",\n    \"popularity\": 5898\n  },\n  {\n    \"tag\": "lemming",\n    \"popularity\": 5893\n  },\n  {\n    \"tag\": "marled subalate",\n    \"popularity\": 5887\n  },\n  {\n    \"tag\": "premial horizonward",\n    \"popularity\": 5882\n  },\n  {\n    \"tag\": "nonrefueling",\n    \"popularity\": 5877\n  },\n  {\n    \"tag\": "rupturewort",\n    \"popularity\": 5872\n  },\n  {\n    \"tag\": "unfed",\n    \"popularity\": 5867\n  },\n  {\n    \"tag\": "empanelment",\n    \"popularity\": 5862\n  },\n  {\n    \"tag\": "isoosmosis",\n    \"popularity\": 5857\n  },\n  {\n    \"tag\": "jipijapa",\n    \"popularity\": 5852\n  },\n  {\n    \"tag\": "Fiji",\n    \"popularity\": 5847\n  },\n  {\n    \"tag\": "interferant",\n    \"popularity\": 5842\n  },\n  {\n    \"tag\": "reconstitution",\n    \"popularity\": 5837\n  },\n  {\n    \"tag\": "dockyardman",\n    \"popularity\": 5832\n  },\n  {\n    \"tag\": "dolichopodous",\n    \"popularity\": 5826\n  },\n  {\n    \"tag\": "whiteworm",\n    \"popularity\": 5821\n  },\n  {\n    \"tag\": "atheistically",\n    \"popularity\": 5816\n  },\n  {\n    \"tag\": "nonconcern",\n    \"popularity\": 5811\n  },\n  {\n    \"tag\": "scarabaeidoid",\n    \"popularity\": 5806\n  },\n  {\n    \"tag\": "triumviri",\n    \"popularity\": 5801\n  },\n  {\n    \"tag\": "rakit",\n    \"popularity\": 5796\n  },\n  {\n    \"tag\": "leecheater",\n    \"popularity\": 5791\n  },\n  {\n    \"tag\": "Arthrostraca",\n    \"popularity\": 5786\n  },\n  {\n    \"tag\": "upknit",\n    \"popularity\": 5781\n  },\n  {\n    \"tag\": "tymbalon",\n    \"popularity\": 5776\n  },\n  {\n    \"tag\": "inventurous",\n    \"popularity\": 5771\n  },\n  {\n    \"tag\": "perradiate",\n    \"popularity\": 5766\n  },\n  {\n    \"tag\": "seer",\n    \"popularity\": 5762\n  },\n  {\n    \"tag\": "Auricularia",\n    \"popularity\": 5757\n  },\n  {\n    \"tag\": "wettish exclusivity",\n    \"popularity\": 5752\n  },\n  {\n    \"tag\": "arteriosympathectomy",\n    \"popularity\": 5747\n  },\n  {\n    \"tag\": "tunlike",\n    \"popularity\": 5742\n  },\n  {\n    \"tag\": "cephalocercal",\n    \"popularity\": 5737\n  },\n  {\n    \"tag\": "meaninglessness",\n    \"popularity\": 5732\n  },\n  {\n    \"tag\": "fountful",\n    \"popularity\": 5727\n  },\n  {\n    \"tag\": "appraisement",\n    \"popularity\": 5722\n  },\n  {\n    \"tag\": "geniculated",\n    \"popularity\": 5717\n  },\n  {\n    \"tag\": "rotator",\n    \"popularity\": 5712\n  },\n  {\n    \"tag\": "foremarch biography",\n    \"popularity\": 5707\n  },\n  {\n    \"tag\": "arid",\n    \"popularity\": 5703\n  },\n  {\n    \"tag\": "inapprehensible",\n    \"popularity\": 5698\n  },\n  {\n    \"tag\": "chlorosulphonic",\n    \"popularity\": 5693\n  },\n  {\n    \"tag\": "braguette",\n    \"popularity\": 5688\n  },\n  {\n    \"tag\": "panophthalmitis",\n    \"popularity\": 5683\n  },\n  {\n    \"tag\": "pro objurgatorily",\n    \"popularity\": 5678\n  },\n  {\n    \"tag\": "zooplasty",\n    \"popularity\": 5673\n  },\n  {\n    \"tag\": "Terebratulidae",\n    \"popularity\": 5669\n  },\n  {\n    \"tag\": "Mahran",\n    \"popularity\": 5664\n  },\n  {\n    \"tag\": "anthologize merocele",\n    \"popularity\": 5659\n  },\n  {\n    \"tag\": "firecracker chiropractic",\n    \"popularity\": 5654\n  },\n  {\n    \"tag\": "tenorist",\n    \"popularity\": 5649\n  },\n  {\n    \"tag\": "amphitene",\n    \"popularity\": 5645\n  },\n  {\n    \"tag\": "silverbush toadstone",\n    \"popularity\": 5640\n  },\n  {\n    \"tag\": "entozoological",\n    \"popularity\": 5635\n  },\n  {\n    \"tag\": "trustlessness",\n    \"popularity\": 5630\n  },\n  {\n    \"tag\": "reassay",\n    \"popularity\": 5625\n  },\n  {\n    \"tag\": "chrysalides",\n    \"popularity\": 5621\n  },\n  {\n    \"tag\": "truncation",\n    \"popularity\": 5616\n  },\n  {\n    \"tag\": "unwavered mausoleal",\n    \"popularity\": 5611\n  },\n  {\n    \"tag\": "unserrated",\n    \"popularity\": 5606\n  },\n  {\n    \"tag\": "frampler",\n    \"popularity\": 5602\n  },\n  {\n    \"tag\": "celestial",\n    \"popularity\": 5597\n  },\n  {\n    \"tag\": "depreter",\n    \"popularity\": 5592\n  },\n  {\n    \"tag\": "retaliate",\n    \"popularity\": 5588\n  },\n  {\n    \"tag\": "decempunctate",\n    \"popularity\": 5583\n  },\n  {\n    \"tag\": "submitter",\n    \"popularity\": 5578\n  },\n  {\n    \"tag\": "phenothiazine",\n    \"popularity\": 5573\n  },\n  {\n    \"tag\": "hobbledehoyish",\n    \"popularity\": 5569\n  },\n  {\n    \"tag\": "erraticness",\n    \"popularity\": 5564\n  },\n  {\n    \"tag\": "ovariodysneuria",\n    \"popularity\": 5559\n  },\n  {\n    \"tag\": "puja",\n    \"popularity\": 5555\n  },\n  {\n    \"tag\": "cesspool",\n    \"popularity\": 5550\n  },\n  {\n    \"tag\": "sonation",\n    \"popularity\": 5545\n  },\n  {\n    \"tag\": "moggan",\n    \"popularity\": 5541\n  },\n  {\n    \"tag\": "overjutting",\n    \"popularity\": 5536\n  },\n  {\n    \"tag\": "cohobate",\n    \"popularity\": 5531\n  },\n  {\n    \"tag\": "Distoma",\n    \"popularity\": 5527\n  },\n  {\n    \"tag\": "Plectognathi",\n    \"popularity\": 5522\n  },\n  {\n    \"tag\": "dumple caliphate",\n    \"popularity\": 5517\n  },\n  {\n    \"tag\": "shiko",\n    \"popularity\": 5513\n  },\n  {\n    \"tag\": "downness",\n    \"popularity\": 5508\n  },\n  {\n    \"tag\": "whippletree",\n    \"popularity\": 5504\n  },\n  {\n    \"tag\": "nymphaeum",\n    \"popularity\": 5499\n  },\n  {\n    \"tag\": "there trest",\n    \"popularity\": 5494\n  },\n  {\n    \"tag\": "psychrometer",\n    \"popularity\": 5490\n  },\n  {\n    \"tag\": "pyelograph",\n    \"popularity\": 5485\n  },\n  {\n    \"tag\": "unsalvable",\n    \"popularity\": 5481\n  },\n  {\n    \"tag\": "bescreen",\n    \"popularity\": 5476\n  },\n  {\n    \"tag\": "cushy",\n    \"popularity\": 5471\n  },\n  {\n    \"tag\": "plicatolobate",\n    \"popularity\": 5467\n  },\n  {\n    \"tag\": "lakie",\n    \"popularity\": 5462\n  },\n  {\n    \"tag\": "anthropodeoxycholic",\n    \"popularity\": 5458\n  },\n  {\n    \"tag\": "resatisfaction",\n    \"popularity\": 5453\n  },\n  {\n    \"tag\": "unravelment unaccidental",\n    \"popularity\": 5449\n  },\n  {\n    \"tag\": "telewriter monogeneous",\n    \"popularity\": 5444\n  },\n  {\n    \"tag\": "unsabred",\n    \"popularity\": 5440\n  },\n  {\n    \"tag\": "startlingly",\n    \"popularity\": 5435\n  },\n  {\n    \"tag\": "Aralia",\n    \"popularity\": 5431\n  },\n  {\n    \"tag\": "alamonti",\n    \"popularity\": 5426\n  },\n  {\n    \"tag\": "Franklinization",\n    \"popularity\": 5422\n  },\n  {\n    \"tag\": "parliament",\n    \"popularity\": 5417\n  },\n  {\n    \"tag\": "schoolkeeper",\n    \"popularity\": 5413\n  },\n  {\n    \"tag\": "nonsociety",\n    \"popularity\": 5408\n  },\n  {\n    \"tag\": "parenthetic",\n    \"popularity\": 5404\n  },\n  {\n    \"tag\": "stog",\n    \"popularity\": 5399\n  },\n  {\n    \"tag\": "Pristipomidae",\n    \"popularity\": 5395\n  },\n  {\n    \"tag\": "exocarp",\n    \"popularity\": 5390\n  },\n  {\n    \"tag\": "monaxonial",\n    \"popularity\": 5386\n  },\n  {\n    \"tag\": "tramroad",\n    \"popularity\": 5381\n  },\n  {\n    \"tag\": "hookah",\n    \"popularity\": 5377\n  },\n  {\n    \"tag\": "saccharonic",\n    \"popularity\": 5372\n  },\n  {\n    \"tag\": "perimetrium",\n    \"popularity\": 5368\n  },\n  {\n    \"tag\": "libelluloid",\n    \"popularity\": 5364\n  },\n  {\n    \"tag\": "overrunningly",\n    \"popularity\": 5359\n  },\n  {\n    \"tag\": "untwister",\n    \"popularity\": 5355\n  },\n  {\n    \"tag\": "ninnyhammer",\n    \"popularity\": 5350\n  },\n  {\n    \"tag\": "metranate",\n    \"popularity\": 5346\n  },\n  {\n    \"tag\": "sarcoblast",\n    \"popularity\": 5341\n  },\n  {\n    \"tag\": "porkish",\n    \"popularity\": 5337\n  },\n  {\n    \"tag\": "chauvinistic",\n    \"popularity\": 5333\n  },\n  {\n    \"tag\": "sexagesimal",\n    \"popularity\": 5328\n  },\n  {\n    \"tag\": "hematogenic",\n    \"popularity\": 5324\n  },\n  {\n    \"tag\": "selfpreservatory",\n    \"popularity\": 5320\n  },\n  {\n    \"tag\": "myelauxe",\n    \"popularity\": 5315\n  },\n  {\n    \"tag\": "triply",\n    \"popularity\": 5311\n  },\n  {\n    \"tag\": "metaphysicous",\n    \"popularity\": 5306\n  },\n  {\n    \"tag\": "vitrinoid",\n    \"popularity\": 5302\n  },\n  {\n    \"tag\": "glabellae",\n    \"popularity\": 5298\n  },\n  {\n    \"tag\": "moonlighter",\n    \"popularity\": 5293\n  },\n  {\n    \"tag\": "monotheistically epexegetical",\n    \"popularity\": 5289\n  },\n  {\n    \"tag\": "pseudolateral",\n    \"popularity\": 5285\n  },\n  {\n    \"tag\": "heptamethylene",\n    \"popularity\": 5280\n  },\n  {\n    \"tag\": "salvadora",\n    \"popularity\": 5276\n  },\n  {\n    \"tag\": "unjovial diphenylthiourea",\n    \"popularity\": 5272\n  },\n  {\n    \"tag\": "thievishness",\n    \"popularity\": 5268\n  },\n  {\n    \"tag\": "unridable",\n    \"popularity\": 5263\n  },\n  {\n    \"tag\": "underhandedly",\n    \"popularity\": 5259\n  },\n  {\n    \"tag\": "fungiform",\n    \"popularity\": 5255\n  },\n  {\n    \"tag\": "scruffle",\n    \"popularity\": 5250\n  },\n  {\n    \"tag\": "preindisposition",\n    \"popularity\": 5246\n  },\n  {\n    \"tag\": "Amadis",\n    \"popularity\": 5242\n  },\n  {\n    \"tag\": "Culex",\n    \"popularity\": 5238\n  },\n  {\n    \"tag\": "churning",\n    \"popularity\": 5233\n  },\n  {\n    \"tag\": "imperite",\n    \"popularity\": 5229\n  },\n  {\n    \"tag\": "levorotation",\n    \"popularity\": 5225\n  },\n  {\n    \"tag\": "barbate",\n    \"popularity\": 5221\n  },\n  {\n    \"tag\": "knotwort",\n    \"popularity\": 5216\n  },\n  {\n    \"tag\": "gypsiferous",\n    \"popularity\": 5212\n  },\n  {\n    \"tag\": "tourmalinic",\n    \"popularity\": 5208\n  },\n  {\n    \"tag\": "helleboric",\n    \"popularity\": 5204\n  },\n  {\n    \"tag\": "pneumograph",\n    \"popularity\": 5199\n  },\n  {\n    \"tag\": "Peltigeraceae",\n    \"popularity\": 5195\n  },\n  {\n    \"tag\": "busine",\n    \"popularity\": 5191\n  },\n  {\n    \"tag\": "Ailuridae",\n    \"popularity\": 5187\n  },\n  {\n    \"tag\": "azotate",\n    \"popularity\": 5183\n  },\n  {\n    \"tag\": "unlikable",\n    \"popularity\": 5178\n  },\n  {\n    \"tag\": "sloyd",\n    \"popularity\": 5174\n  },\n  {\n    \"tag\": "biblioclasm",\n    \"popularity\": 5170\n  },\n  {\n    \"tag\": "Seres",\n    \"popularity\": 5166\n  },\n  {\n    \"tag\": "unaccurateness",\n    \"popularity\": 5162\n  },\n  {\n    \"tag\": "scrollwise",\n    \"popularity\": 5157\n  },\n  {\n    \"tag\": "flandowser",\n    \"popularity\": 5153\n  },\n  {\n    \"tag\": "unblackened",\n    \"popularity\": 5149\n  },\n  {\n    \"tag\": "schistosternia",\n    \"popularity\": 5145\n  },\n  {\n    \"tag\": "fuse",\n    \"popularity\": 5141\n  },\n  {\n    \"tag\": "narthecal",\n    \"popularity\": 5137\n  },\n  {\n    \"tag\": "Cueva",\n    \"popularity\": 5133\n  },\n  {\n    \"tag\": "appositeness",\n    \"popularity\": 5128\n  },\n  {\n    \"tag\": "proindustrial",\n    \"popularity\": 5124\n  },\n  {\n    \"tag\": "dermatorrhoea",\n    \"popularity\": 5120\n  },\n  {\n    \"tag\": "oxyurous tendential",\n    \"popularity\": 5116\n  },\n  {\n    \"tag\": "isopurpurin",\n    \"popularity\": 5112\n  },\n  {\n    \"tag\": "impose",\n    \"popularity\": 5108\n  },\n  {\n    \"tag\": "wordsmanship",\n    \"popularity\": 5104\n  },\n  {\n    \"tag\": "saturator",\n    \"popularity\": 5100\n  },\n  {\n    \"tag\": "Nordicity",\n    \"popularity\": 5096\n  },\n  {\n    \"tag\": "interaccuse",\n    \"popularity\": 5092\n  },\n  {\n    \"tag\": "acridinic",\n    \"popularity\": 5087\n  },\n  {\n    \"tag\": "scholion",\n    \"popularity\": 5083\n  },\n  {\n    \"tag\": "pseudoaconitine",\n    \"popularity\": 5079\n  },\n  {\n    \"tag\": "doctorial",\n    \"popularity\": 5075\n  },\n  {\n    \"tag\": "Etchimin",\n    \"popularity\": 5071\n  },\n  {\n    \"tag\": "oliviform",\n    \"popularity\": 5067\n  },\n  {\n    \"tag\": "Pele",\n    \"popularity\": 5063\n  },\n  {\n    \"tag\": "Chiromantis Progymnasium",\n    \"popularity\": 5059\n  },\n  {\n    \"tag\": "toxosis",\n    \"popularity\": 5055\n  },\n  {\n    \"tag\": "spadilla",\n    \"popularity\": 5051\n  },\n  {\n    \"tag\": "Actinopterygii",\n    \"popularity\": 5047\n  },\n  {\n    \"tag\": "untiring",\n    \"popularity\": 5043\n  },\n  {\n    \"tag\": "butyral",\n    \"popularity\": 5039\n  },\n  {\n    \"tag\": "Gymnoderinae",\n    \"popularity\": 5035\n  },\n  {\n    \"tag\": "testudo",\n    \"popularity\": 5031\n  },\n  {\n    \"tag\": "frigorify",\n    \"popularity\": 5027\n  },\n  {\n    \"tag\": "aliency",\n    \"popularity\": 5023\n  },\n  {\n    \"tag\": "jargon",\n    \"popularity\": 5019\n  },\n  {\n    \"tag\": "counterservice",\n    \"popularity\": 5015\n  },\n  {\n    \"tag\": "isostrychnine",\n    \"popularity\": 5011\n  },\n  {\n    \"tag\": "tellership",\n    \"popularity\": 5007\n  },\n  {\n    \"tag\": "miscegenetic",\n    \"popularity\": 5003\n  },\n  {\n    \"tag\": "sorcer",\n    \"popularity\": 4999\n  },\n  {\n    \"tag\": "tilewright",\n    \"popularity\": 4995\n  },\n  {\n    \"tag\": "cyanoplastid",\n    \"popularity\": 4991\n  },\n  {\n    \"tag\": "fluxionally",\n    \"popularity\": 4987\n  },\n  {\n    \"tag\": "proudhearted",\n    \"popularity\": 4983\n  },\n  {\n    \"tag\": "blithely",\n    \"popularity\": 4979\n  },\n  {\n    \"tag\": "jestproof",\n    \"popularity\": 4975\n  },\n  {\n    \"tag\": "jestwise",\n    \"popularity\": 4971\n  },\n  {\n    \"tag\": "nonassimilable",\n    \"popularity\": 4967\n  },\n  {\n    \"tag\": "compurgation",\n    \"popularity\": 4964\n  },\n  {\n    \"tag\": "unhate",\n    \"popularity\": 4960\n  },\n  {\n    \"tag\": "haplodonty",\n    \"popularity\": 4956\n  },\n  {\n    \"tag\": "cardholder",\n    \"popularity\": 4952\n  },\n  {\n    \"tag\": "rainlight megohmmeter overstout",\n    \"popularity\": 4948\n  },\n  {\n    \"tag\": "itchless",\n    \"popularity\": 4944\n  },\n  {\n    \"tag\": "begiggle",\n    \"popularity\": 4940\n  },\n  {\n    \"tag\": "chromatosphere",\n    \"popularity\": 4936\n  },\n  {\n    \"tag\": "typicality",\n    \"popularity\": 4932\n  },\n  {\n    \"tag\": "overgrown",\n    \"popularity\": 4928\n  },\n  {\n    \"tag\": "envolume",\n    \"popularity\": 4925\n  },\n  {\n    \"tag\": "pachycholia",\n    \"popularity\": 4921\n  },\n  {\n    \"tag\": "passageable",\n    \"popularity\": 4917\n  },\n  {\n    \"tag\": "pathopoiesis",\n    \"popularity\": 4913\n  },\n  {\n    \"tag\": "overbreak",\n    \"popularity\": 4909\n  },\n  {\n    \"tag\": "satyric",\n    \"popularity\": 4905\n  },\n  {\n    \"tag\": "unaudited",\n    \"popularity\": 4901\n  },\n  {\n    \"tag\": "whimble",\n    \"popularity\": 4898\n  },\n  {\n    \"tag\": "pressureless",\n    \"popularity\": 4894\n  },\n  {\n    \"tag\": "Selene",\n    \"popularity\": 4890\n  },\n  {\n    \"tag\": "slithery",\n    \"popularity\": 4886\n  },\n  {\n    \"tag\": "nondisfigurement",\n    \"popularity\": 4882\n  },\n  {\n    \"tag\": "overdelicious",\n    \"popularity\": 4878\n  },\n  {\n    \"tag\": "Perca",\n    \"popularity\": 4875\n  },\n  {\n    \"tag\": "Palladium",\n    \"popularity\": 4871\n  },\n  {\n    \"tag\": "insagacity",\n    \"popularity\": 4867\n  },\n  {\n    \"tag\": "peristoma",\n    \"popularity\": 4863\n  },\n  {\n    \"tag\": "uncreativeness",\n    \"popularity\": 4859\n  },\n  {\n    \"tag\": "incomparability surfboarding",\n    \"popularity\": 4856\n  },\n  {\n    \"tag\": "bacillar",\n    \"popularity\": 4852\n  },\n  {\n    \"tag\": "ulcerative",\n    \"popularity\": 4848\n  },\n  {\n    \"tag\": "stychomythia",\n    \"popularity\": 4844\n  },\n  {\n    \"tag\": "sesma somatics nonentry",\n    \"popularity\": 4840\n  },\n  {\n    \"tag\": "unsepulchred",\n    \"popularity\": 4837\n  },\n  {\n    \"tag\": "cephalanthium",\n    \"popularity\": 4833\n  },\n  {\n    \"tag\": "Asiaticization",\n    \"popularity\": 4829\n  },\n  {\n    \"tag\": "killeen",\n    \"popularity\": 4825\n  },\n  {\n    \"tag\": "Pseudococcus",\n    \"popularity\": 4822\n  },\n  {\n    \"tag\": "untractable",\n    \"popularity\": 4818\n  },\n  {\n    \"tag\": "apolegamic",\n    \"popularity\": 4814\n  },\n  {\n    \"tag\": "hyperpnea",\n    \"popularity\": 4810\n  },\n  {\n    \"tag\": "martyrolatry",\n    \"popularity\": 4807\n  },\n  {\n    \"tag\": "Sarmatic",\n    \"popularity\": 4803\n  },\n  {\n    \"tag\": "nonsurface",\n    \"popularity\": 4799\n  },\n  {\n    \"tag\": "adjoined",\n    \"popularity\": 4796\n  },\n  {\n    \"tag\": "vasiform",\n    \"popularity\": 4792\n  },\n  {\n    \"tag\": "tastelessness",\n    \"popularity\": 4788\n  },\n  {\n    \"tag\": "rumbo",\n    \"popularity\": 4784\n  },\n  {\n    \"tag\": "subdititious",\n    \"popularity\": 4781\n  },\n  {\n    \"tag\": "reparticipation",\n    \"popularity\": 4777\n  },\n  {\n    \"tag\": "Yorkshireism",\n    \"popularity\": 4773\n  },\n  {\n    \"tag\": "outcrow",\n    \"popularity\": 4770\n  },\n  {\n    \"tag\": "casserole",\n    \"popularity\": 4766\n  },\n  {\n    \"tag\": "semideltaic",\n    \"popularity\": 4762\n  },\n  {\n    \"tag\": "freemason",\n    \"popularity\": 4759\n  },\n  {\n    \"tag\": "catkin",\n    \"popularity\": 4755\n  },\n  {\n    \"tag\": "conscient",\n    \"popularity\": 4751\n  },\n  {\n    \"tag\": "reliably",\n    \"popularity\": 4748\n  },\n  {\n    \"tag\": "Telembi",\n    \"popularity\": 4744\n  },\n  {\n    \"tag\": "hide",\n    \"popularity\": 4740\n  },\n  {\n    \"tag\": "social",\n    \"popularity\": 4737\n  },\n  {\n    \"tag\": "ichneutic",\n    \"popularity\": 4733\n  },\n  {\n    \"tag\": "polypotome blouse pentagrammatic",\n    \"popularity\": 4729\n  },\n  {\n    \"tag\": "airdrome pesthole",\n    \"popularity\": 4726\n  },\n  {\n    \"tag\": "unportended",\n    \"popularity\": 4722\n  },\n  {\n    \"tag\": "sheerly",\n    \"popularity\": 4719\n  },\n  {\n    \"tag\": "acardiac",\n    \"popularity\": 4715\n  },\n  {\n    \"tag\": "fetor",\n    \"popularity\": 4711\n  },\n  {\n    \"tag\": "storax",\n    \"popularity\": 4708\n  },\n  {\n    \"tag\": "syndactylic",\n    \"popularity\": 4704\n  },\n  {\n    \"tag\": "otiatrics",\n    \"popularity\": 4700\n  },\n  {\n    \"tag\": "range",\n    \"popularity\": 4697\n  },\n  {\n    \"tag\": "branchway",\n    \"popularity\": 4693\n  },\n  {\n    \"tag\": "beatific",\n    \"popularity\": 4690\n  },\n  {\n    \"tag\": "Rugosa",\n    \"popularity\": 4686\n  },\n  {\n    \"tag\": "rafty",\n    \"popularity\": 4682\n  },\n  {\n    \"tag\": "gapy",\n    \"popularity\": 4679\n  },\n  {\n    \"tag\": "heterocercal",\n    \"popularity\": 4675\n  },\n  {\n    \"tag\": "actinopterygious",\n    \"popularity\": 4672\n  },\n  {\n    \"tag\": "glauconite",\n    \"popularity\": 4668\n  },\n  {\n    \"tag\": "limbless priest",\n    \"popularity\": 4665\n  },\n  {\n    \"tag\": "chrysene",\n    \"popularity\": 4661\n  },\n  {\n    \"tag\": "isentropic",\n    \"popularity\": 4658\n  },\n  {\n    \"tag\": "lairdess",\n    \"popularity\": 4654\n  },\n  {\n    \"tag\": "butterhead choliambic",\n    \"popularity\": 4650\n  },\n  {\n    \"tag\": "hexaseme",\n    \"popularity\": 4647\n  },\n  {\n    \"tag\": "treeify",\n    \"popularity\": 4643\n  },\n  {\n    \"tag\": "coronetted fructify",\n    \"popularity\": 4640\n  },\n  {\n    \"tag\": "admiralty",\n    \"popularity\": 4636\n  },\n  {\n    \"tag\": "Flosculariidae",\n    \"popularity\": 4633\n  },\n  {\n    \"tag\": "limaceous",\n    \"popularity\": 4629\n  },\n  {\n    \"tag\": "subterconscious",\n    \"popularity\": 4626\n  },\n  {\n    \"tag\": "stayless",\n    \"popularity\": 4622\n  },\n  {\n    \"tag\": "psha",\n    \"popularity\": 4619\n  },\n  {\n    \"tag\": "Mediterraneanize",\n    \"popularity\": 4615\n  },\n  {\n    \"tag\": "impenetrably",\n    \"popularity\": 4612\n  },\n  {\n    \"tag\": "Myrmeleonidae",\n    \"popularity\": 4608\n  },\n  {\n    \"tag\": "germander",\n    \"popularity\": 4605\n  },\n  {\n    \"tag\": "Buri",\n    \"popularity\": 4601\n  },\n  {\n    \"tag\": "papyrotamia",\n    \"popularity\": 4598\n  },\n  {\n    \"tag\": "Toxylon",\n    \"popularity\": 4594\n  },\n  {\n    \"tag\": "batatilla",\n    \"popularity\": 4591\n  },\n  {\n    \"tag\": "fabella assumer",\n    \"popularity\": 4587\n  },\n  {\n    \"tag\": "macromethod",\n    \"popularity\": 4584\n  },\n  {\n    \"tag\": "Blechnum",\n    \"popularity\": 4580\n  },\n  {\n    \"tag\": "pantography",\n    \"popularity\": 4577\n  },\n  {\n    \"tag\": "seminovel",\n    \"popularity\": 4574\n  },\n  {\n    \"tag\": "disembarrassment",\n    \"popularity\": 4570\n  },\n  {\n    \"tag\": "bushmaking",\n    \"popularity\": 4567\n  },\n  {\n    \"tag\": "neurosis",\n    \"popularity\": 4563\n  },\n  {\n    \"tag\": "Animalia",\n    \"popularity\": 4560\n  },\n  {\n    \"tag\": "Bernice",\n    \"popularity\": 4556\n  },\n  {\n    \"tag\": "wisen",\n    \"popularity\": 4553\n  },\n  {\n    \"tag\": "subhymenium",\n    \"popularity\": 4549\n  },\n  {\n    \"tag\": "esophagomycosis",\n    \"popularity\": 4546\n  },\n  {\n    \"tag\": "wireworks",\n    \"popularity\": 4543\n  },\n  {\n    \"tag\": "Sabellidae",\n    \"popularity\": 4539\n  },\n  {\n    \"tag\": "fustianish",\n    \"popularity\": 4536\n  },\n  {\n    \"tag\": "professively",\n    \"popularity\": 4532\n  },\n  {\n    \"tag\": "overcorruptly",\n    \"popularity\": 4529\n  },\n  {\n    \"tag\": "overcreep",\n    \"popularity\": 4526\n  },\n  {\n    \"tag\": "Castilloa",\n    \"popularity\": 4522\n  },\n  {\n    \"tag\": "forelady Georgie",\n    \"popularity\": 4519\n  },\n  {\n    \"tag\": "outsider",\n    \"popularity\": 4515\n  },\n  {\n    \"tag\": "Enukki",\n    \"popularity\": 4512\n  },\n  {\n    \"tag\": "gypsy",\n    \"popularity\": 4509\n  },\n  {\n    \"tag\": "Passamaquoddy",\n    \"popularity\": 4505\n  },\n  {\n    \"tag\": "reposit",\n    \"popularity\": 4502\n  },\n  {\n    \"tag\": "overtenderness",\n    \"popularity\": 4499\n  },\n  {\n    \"tag\": "keratome",\n    \"popularity\": 4495\n  },\n  {\n    \"tag\": "interclavicular hypermonosyllable Susanna",\n    \"popularity\": 4492\n  },\n  {\n    \"tag\": "mispropose",\n    \"popularity\": 4489\n  },\n  {\n    \"tag\": "Membranipora",\n    \"popularity\": 4485\n  },\n  {\n    \"tag\": "lampad",\n    \"popularity\": 4482\n  },\n  {\n    \"tag\": "header",\n    \"popularity\": 4479\n  },\n  {\n    \"tag\": "triseriate",\n    \"popularity\": 4475\n  },\n  {\n    \"tag\": "distrainment",\n    \"popularity\": 4472\n  },\n  {\n    \"tag\": "staphyloplastic",\n    \"popularity\": 4469\n  },\n  {\n    \"tag\": "outscour",\n    \"popularity\": 4465\n  },\n  {\n    \"tag\": "tallowmaking",\n    \"popularity\": 4462\n  },\n  {\n    \"tag\": "plugger",\n    \"popularity\": 4459\n  },\n  {\n    \"tag\": "fashionize",\n    \"popularity\": 4455\n  },\n  {\n    \"tag\": "puzzle",\n    \"popularity\": 4452\n  },\n  {\n    \"tag\": "imbrue",\n    \"popularity\": 4449\n  },\n  {\n    \"tag\": "osteoblast",\n    \"popularity\": 4445\n  },\n  {\n    \"tag\": "Hydrocores",\n    \"popularity\": 4442\n  },\n  {\n    \"tag\": "Lutra",\n    \"popularity\": 4439\n  },\n  {\n    \"tag\": "upridge scarfy",\n    \"popularity\": 4435\n  },\n  {\n    \"tag\": "ancon taffle",\n    \"popularity\": 4432\n  },\n  {\n    \"tag\": "impest",\n    \"popularity\": 4429\n  },\n  {\n    \"tag\": "uncollatedness",\n    \"popularity\": 4426\n  },\n  {\n    \"tag\": "hypersensitize",\n    \"popularity\": 4422\n  },\n  {\n    \"tag\": "autographically",\n    \"popularity\": 4419\n  },\n  {\n    \"tag\": "louther",\n    \"popularity\": 4416\n  },\n  {\n    \"tag\": "Ollie",\n    \"popularity\": 4413\n  },\n  {\n    \"tag\": "recompensate",\n    \"popularity\": 4409\n  },\n  {\n    \"tag\": "Shan",\n    \"popularity\": 4406\n  },\n  {\n    \"tag\": "brachycnemic",\n    \"popularity\": 4403\n  },\n  {\n    \"tag\": "Carinatae",\n    \"popularity\": 4399\n  },\n  {\n    \"tag\": "geotherm",\n    \"popularity\": 4396\n  },\n  {\n    \"tag\": "sawback",\n    \"popularity\": 4393\n  },\n  {\n    \"tag\": "Novatianist",\n    \"popularity\": 4390\n  },\n  {\n    \"tag\": "reapproach",\n    \"popularity\": 4387\n  },\n  {\n    \"tag\": "myelopoietic",\n    \"popularity\": 4383\n  },\n  {\n    \"tag\": "cyanin",\n    \"popularity\": 4380\n  },\n  {\n    \"tag\": "unsmutted",\n    \"popularity\": 4377\n  },\n  {\n    \"tag\": "nonpapist",\n    \"popularity\": 4374\n  },\n  {\n    \"tag\": "transbaikalian",\n    \"popularity\": 4370\n  },\n  {\n    \"tag\": "connately",\n    \"popularity\": 4367\n  },\n  {\n    \"tag\": "tenderize iterance",\n    \"popularity\": 4364\n  },\n  {\n    \"tag\": "hydrostatical",\n    \"popularity\": 4361\n  },\n  {\n    \"tag\": "unflag",\n    \"popularity\": 4358\n  },\n  {\n    \"tag\": "translate",\n    \"popularity\": 4354\n  },\n  {\n    \"tag\": "Scorzonera",\n    \"popularity\": 4351\n  },\n  {\n    \"tag\": "uncomforted",\n    \"popularity\": 4348\n  },\n  {\n    \"tag\": "risser varied",\n    \"popularity\": 4345\n  },\n  {\n    \"tag\": "plumbate",\n    \"popularity\": 4342\n  },\n  {\n    \"tag\": "Usneaceae",\n    \"popularity\": 4338\n  },\n  {\n    \"tag\": "fohat",\n    \"popularity\": 4335\n  },\n  {\n    \"tag\": "slagging",\n    \"popularity\": 4332\n  },\n  {\n    \"tag\": "superserious",\n    \"popularity\": 4329\n  },\n  {\n    \"tag\": "theocracy",\n    \"popularity\": 4326\n  },\n  {\n    \"tag\": "valonia",\n    \"popularity\": 4323\n  },\n  {\n    \"tag\": "Sapindales",\n    \"popularity\": 4319\n  },\n  {\n    \"tag\": "palaeozoologist",\n    \"popularity\": 4316\n  },\n  {\n    \"tag\": "yalb",\n    \"popularity\": 4313\n  },\n  {\n    \"tag\": "unviewed",\n    \"popularity\": 4310\n  },\n  {\n    \"tag\": "polyarteritis",\n    \"popularity\": 4307\n  },\n  {\n    \"tag\": "vectorial",\n    \"popularity\": 4304\n  },\n  {\n    \"tag\": "skimpingly",\n    \"popularity\": 4301\n  },\n  {\n    \"tag\": "athort",\n    \"popularity\": 4297\n  },\n  {\n    \"tag\": "tribofluorescence",\n    \"popularity\": 4294\n  },\n  {\n    \"tag\": "benzonitrol",\n    \"popularity\": 4291\n  },\n  {\n    \"tag\": "swiller subobtuse subjacency",\n    \"popularity\": 4288\n  },\n  {\n    \"tag\": "uncompassed",\n    \"popularity\": 4285\n  },\n  {\n    \"tag\": "cacochymia",\n    \"popularity\": 4282\n  },\n  {\n    \"tag\": "commensalist butadiene",\n    \"popularity\": 4279\n  },\n  {\n    \"tag\": "culpable",\n    \"popularity\": 4276\n  },\n  {\n    \"tag\": "contributive",\n    \"popularity\": 4273\n  },\n  {\n    \"tag\": "attemperately",\n    \"popularity\": 4269\n  },\n  {\n    \"tag\": "spelt",\n    \"popularity\": 4266\n  },\n  {\n    \"tag\": "exoneration",\n    \"popularity\": 4263\n  },\n  {\n    \"tag\": "antivivisectionist",\n    \"popularity\": 4260\n  },\n  {\n    \"tag\": "granitification",\n    \"popularity\": 4257\n  },\n  {\n    \"tag\": "palladize",\n    \"popularity\": 4254\n  },\n  {\n    \"tag\": "marksmanship",\n    \"popularity\": 4251\n  },\n  {\n    \"tag\": "bullydom",\n    \"popularity\": 4248\n  },\n  {\n    \"tag\": "spirality",\n    \"popularity\": 4245\n  },\n  {\n    \"tag\": "caliginous",\n    \"popularity\": 4242\n  },\n  {\n    \"tag\": "reportedly",\n    \"popularity\": 4239\n  },\n  {\n    \"tag\": "polyad",\n    \"popularity\": 4236\n  },\n  {\n    \"tag\": "arthroempyesis",\n    \"popularity\": 4233\n  },\n  {\n    \"tag\": "semibay facultatively",\n    \"popularity\": 4229\n  },\n  {\n    \"tag\": "metastatically",\n    \"popularity\": 4226\n  },\n  {\n    \"tag\": "prophetically",\n    \"popularity\": 4223\n  },\n  {\n    \"tag\": "Linguatula elapid",\n    \"popularity\": 4220\n  },\n  {\n    \"tag\": "pyknatom",\n    \"popularity\": 4217\n  },\n  {\n    \"tag\": "centimeter",\n    \"popularity\": 4214\n  },\n  {\n    \"tag\": "mensurate",\n    \"popularity\": 4211\n  },\n  {\n    \"tag\": "migraine",\n    \"popularity\": 4208\n  },\n  {\n    \"tag\": "pentagamist",\n    \"popularity\": 4205\n  },\n  {\n    \"tag\": "querken",\n    \"popularity\": 4202\n  },\n  {\n    \"tag\": "ambulance",\n    \"popularity\": 4199\n  },\n  {\n    \"tag\": "Stokavian",\n    \"popularity\": 4196\n  },\n  {\n    \"tag\": "malvasian",\n    \"popularity\": 4193\n  },\n  {\n    \"tag\": "uncouthsome",\n    \"popularity\": 4190\n  },\n  {\n    \"tag\": "readable",\n    \"popularity\": 4187\n  },\n  {\n    \"tag\": "enlodge",\n    \"popularity\": 4184\n  },\n  {\n    \"tag\": "plasterwise Appendiculariidae perspectograph",\n    \"popularity\": 4181\n  },\n  {\n    \"tag\": "inkweed",\n    \"popularity\": 4178\n  },\n  {\n    \"tag\": "streep",\n    \"popularity\": 4175\n  },\n  {\n    \"tag\": "diadelphian cultured",\n    \"popularity\": 4172\n  },\n  {\n    \"tag\": "hymenopterous",\n    \"popularity\": 4169\n  },\n  {\n    \"tag\": "unexorableness",\n    \"popularity\": 4166\n  },\n  {\n    \"tag\": "cascaron",\n    \"popularity\": 4163\n  },\n  {\n    \"tag\": "undaintiness",\n    \"popularity\": 4160\n  },\n  {\n    \"tag\": "Curtana",\n    \"popularity\": 4157\n  },\n  {\n    \"tag\": "scurvied",\n    \"popularity\": 4154\n  },\n  {\n    \"tag\": "molluscoidal",\n    \"popularity\": 4151\n  },\n  {\n    \"tag\": "yurt",\n    \"popularity\": 4148\n  },\n  {\n    \"tag\": "deciduitis",\n    \"popularity\": 4145\n  },\n  {\n    \"tag\": "creephole",\n    \"popularity\": 4142\n  },\n  {\n    \"tag\": "quatrefeuille",\n    \"popularity\": 4139\n  },\n  {\n    \"tag\": "bicapitate adenomatome",\n    \"popularity\": 4136\n  },\n  {\n    \"tag\": "damassin",\n    \"popularity\": 4134\n  },\n  {\n    \"tag\": "planching",\n    \"popularity\": 4131\n  },\n  {\n    \"tag\": "dashedly inferential",\n    \"popularity\": 4128\n  },\n  {\n    \"tag\": "lobe",\n    \"popularity\": 4125\n  },\n  {\n    \"tag\": "Hyrachyus",\n    \"popularity\": 4122\n  },\n  {\n    \"tag\": "knab",\n    \"popularity\": 4119\n  },\n  {\n    \"tag\": "discohexaster",\n    \"popularity\": 4116\n  },\n  {\n    \"tag\": "malign",\n    \"popularity\": 4113\n  },\n  {\n    \"tag\": "pedagoguism",\n    \"popularity\": 4110\n  },\n  {\n    \"tag\": "shrubbery",\n    \"popularity\": 4107\n  },\n  {\n    \"tag\": "undershrub",\n    \"popularity\": 4104\n  },\n  {\n    \"tag\": "bureaucrat",\n    \"popularity\": 4101\n  },\n  {\n    \"tag\": "pantaleon",\n    \"popularity\": 4098\n  },\n  {\n    \"tag\": "mesoventral",\n    \"popularity\": 4096\n  }]';
+
+for (var i = 0; i < 30; ++i) {
+    var log2 = Math.log(2);
+    var tagInfo = tagInfoJSON.parseJSON(function(a, b) { if (a == "popularity") { return Math.log(b) / log2; } else {return b; } });
+
+    function makeTagCloud(tagInfo)
+    {
+        var output = '<div class="tagCloud" style="width: 100%">';
+
+        tagInfo.sort(function(a, b) { if (a.tag < b.tag) { return -1; } else if (a.tag == b.tag) { return 0; } else return 1; });
+
+        for (var i = 0; i < tagInfo.length; i++) {
+            var tag = tagInfo[i].tag;
+
+            var validates = true;
+            for (var j = 0; j < tag.length; j++) {
+                var ch = tag.charCodeAt(j);
+                if (ch < 0x20 || ch >= 0x7f) {
+                    validates = false;
+                    break;
+                }
+            }
+
+            if (!validates)
+                continue;
+
+            var url = "http://example.com/tag/" + tag.replace(" ", "").toLowerCase();
+            var popularity = tagInfo[i].popularity;
+            var color = 'rgb(' + Math.floor(255 * (popularity - 12) / 20) + ', 0, 255)';
+            output += ' <a href="' + url + '" style="font-size: ' + popularity + 'px; color: ' + color + '">' + tag + '</a> \n';
+        }
+
+        output += '</div>';
+        output.replace(" ", "&nbsp;");
+
+        return output;
+    }
+
+    var tagcloud = makeTagCloud(tagInfo);
+
+    var expectedMinLength = 315000;
+
+    if (tagcloud.length < expectedMinLength)
+        throw "ERROR: bad result: expected length at least " + expectedMinLength + " but got " + tagcloud.length;
+
+    tagInfo = null;
+}
+
-- 
1.8.3.1