GC constraint solving should be parallel
[WebKit-https.git] / PerformanceTests / LongSpider / string-fasta.js
1 // The Great Computer Language Shootout
2 //  http://shootout.alioth.debian.org
3 //
4 //  Contributed by Ian Osgood
5
6 var last = 42, A = 3877, C = 29573, M = 139968;
7
8 function rand(max) {
9   last = (last * A + C) % M;
10   return max * last / M;
11 }
12
13 var ALU =
14   "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
15   "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
16   "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
17   "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
18   "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
19   "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
20   "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
21
22 var IUB = {
23   a:0.27, c:0.12, g:0.12, t:0.27,
24   B:0.02, D:0.02, H:0.02, K:0.02,
25   M:0.02, N:0.02, R:0.02, S:0.02,
26   V:0.02, W:0.02, Y:0.02
27 }
28
29 var HomoSap = {
30   a: 0.3029549426680,
31   c: 0.1979883004921,
32   g: 0.1975473066391,
33   t: 0.3015094502008
34 }
35
36 function makeCumulative(table) {
37   var last = null;
38   for (var c in table) {
39     if (last) table[c] += table[last];
40     last = c;
41   }
42 }
43
44 function fastaRepeat(n, seq) {
45   var seqi = 0, lenOut = 60;
46   while (n>0) {
47     if (n<lenOut) lenOut = n;
48     if (seqi + lenOut < seq.length) {
49       ret += seq.substring(seqi, seqi+lenOut).length;
50       seqi += lenOut;
51     } else {
52       var s = seq.substring(seqi);
53       seqi = lenOut - s.length;
54       ret += (s + seq.substring(0, seqi)).length;
55     }
56     n -= lenOut;
57   }
58 }
59
60 function fastaRandom(n, table) {
61   var line = new Array(60);
62   makeCumulative(table);
63   while (n>0) {
64     if (n<line.length) line = new Array(n);
65     for (var i=0; i<line.length; i++) {
66       var r = rand(1);
67       for (var c in table) {
68         if (r < table[c]) {
69           line[i] = c;
70           break;
71         }
72       }
73     }
74     ret += line.join('').length;
75     n -= line.length;
76   }
77 }
78
79 var ret = 0;
80
81 var count = 700;
82 fastaRepeat(2*count*100000, ALU);
83 fastaRandom(3*count*1000, IUB);
84 fastaRandom(5*count*1000, HomoSap);
85
86 var expected = 145600000;
87
88 if (ret != expected)
89     throw "ERROR: bad result: expected " + expected + " but got " + ret;
90